ID: 925971680

View in Genome Browser
Species Human (GRCh38)
Location 2:9110699-9110721
Sequence TCTGAGCGTGCAAGAGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925971671_925971680 25 Left 925971671 2:9110651-9110673 CCCCTGGAAGTTCTGCAGCCTGA No data
Right 925971680 2:9110699-9110721 TCTGAGCGTGCAAGAGGCTCAGG No data
925971675_925971680 -2 Left 925971675 2:9110678-9110700 CCGTCCTCAGACCACTCTGCCTC No data
Right 925971680 2:9110699-9110721 TCTGAGCGTGCAAGAGGCTCAGG No data
925971673_925971680 23 Left 925971673 2:9110653-9110675 CCTGGAAGTTCTGCAGCCTGAGC No data
Right 925971680 2:9110699-9110721 TCTGAGCGTGCAAGAGGCTCAGG No data
925971676_925971680 -6 Left 925971676 2:9110682-9110704 CCTCAGACCACTCTGCCTCTGAG No data
Right 925971680 2:9110699-9110721 TCTGAGCGTGCAAGAGGCTCAGG No data
925971674_925971680 7 Left 925971674 2:9110669-9110691 CCTGAGCTGCCGTCCTCAGACCA No data
Right 925971680 2:9110699-9110721 TCTGAGCGTGCAAGAGGCTCAGG No data
925971672_925971680 24 Left 925971672 2:9110652-9110674 CCCTGGAAGTTCTGCAGCCTGAG No data
Right 925971680 2:9110699-9110721 TCTGAGCGTGCAAGAGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925971680 Original CRISPR TCTGAGCGTGCAAGAGGCTC AGG Intergenic