ID: 925971682

View in Genome Browser
Species Human (GRCh38)
Location 2:9110710-9110732
Sequence AAGAGGCTCAGGGCCTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925971677_925971682 -2 Left 925971677 2:9110689-9110711 CCACTCTGCCTCTGAGCGTGCAA No data
Right 925971682 2:9110710-9110732 AAGAGGCTCAGGGCCTTTCCAGG No data
925971676_925971682 5 Left 925971676 2:9110682-9110704 CCTCAGACCACTCTGCCTCTGAG No data
Right 925971682 2:9110710-9110732 AAGAGGCTCAGGGCCTTTCCAGG No data
925971679_925971682 -10 Left 925971679 2:9110697-9110719 CCTCTGAGCGTGCAAGAGGCTCA No data
Right 925971682 2:9110710-9110732 AAGAGGCTCAGGGCCTTTCCAGG No data
925971675_925971682 9 Left 925971675 2:9110678-9110700 CCGTCCTCAGACCACTCTGCCTC No data
Right 925971682 2:9110710-9110732 AAGAGGCTCAGGGCCTTTCCAGG No data
925971674_925971682 18 Left 925971674 2:9110669-9110691 CCTGAGCTGCCGTCCTCAGACCA No data
Right 925971682 2:9110710-9110732 AAGAGGCTCAGGGCCTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925971682 Original CRISPR AAGAGGCTCAGGGCCTTTCC AGG Intergenic