ID: 925971748

View in Genome Browser
Species Human (GRCh38)
Location 2:9111073-9111095
Sequence CGCTGCCTTCCCTGGAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925971748_925971757 19 Left 925971748 2:9111073-9111095 CCAGAACTCCAGGGAAGGCAGCG No data
Right 925971757 2:9111115-9111137 GAGCACCAAGAGGGGCGCAAGGG No data
925971748_925971754 10 Left 925971748 2:9111073-9111095 CCAGAACTCCAGGGAAGGCAGCG No data
Right 925971754 2:9111106-9111128 ACGTTCACAGAGCACCAAGAGGG No data
925971748_925971756 18 Left 925971748 2:9111073-9111095 CCAGAACTCCAGGGAAGGCAGCG No data
Right 925971756 2:9111114-9111136 AGAGCACCAAGAGGGGCGCAAGG No data
925971748_925971755 11 Left 925971748 2:9111073-9111095 CCAGAACTCCAGGGAAGGCAGCG No data
Right 925971755 2:9111107-9111129 CGTTCACAGAGCACCAAGAGGGG No data
925971748_925971753 9 Left 925971748 2:9111073-9111095 CCAGAACTCCAGGGAAGGCAGCG No data
Right 925971753 2:9111105-9111127 AACGTTCACAGAGCACCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925971748 Original CRISPR CGCTGCCTTCCCTGGAGTTC TGG (reversed) Intergenic
No off target data available for this crispr