ID: 925973078

View in Genome Browser
Species Human (GRCh38)
Location 2:9121301-9121323
Sequence TCACCTGACCTGTGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925973078_925973084 12 Left 925973078 2:9121301-9121323 CCTTCTGCCCACAGGTCAGGTGA No data
Right 925973084 2:9121336-9121358 AGAGCAGGTGTGTCTTAAGCAGG No data
925973078_925973085 20 Left 925973078 2:9121301-9121323 CCTTCTGCCCACAGGTCAGGTGA No data
Right 925973085 2:9121344-9121366 TGTGTCTTAAGCAGGTCCCTCGG No data
925973078_925973081 -3 Left 925973078 2:9121301-9121323 CCTTCTGCCCACAGGTCAGGTGA No data
Right 925973081 2:9121321-9121343 TGAGACTGACCCAGCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925973078 Original CRISPR TCACCTGACCTGTGGGCAGA AGG (reversed) Intergenic
No off target data available for this crispr