ID: 925973081

View in Genome Browser
Species Human (GRCh38)
Location 2:9121321-9121343
Sequence TGAGACTGACCCAGCAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925973079_925973081 -10 Left 925973079 2:9121308-9121330 CCCACAGGTCAGGTGAGACTGAC No data
Right 925973081 2:9121321-9121343 TGAGACTGACCCAGCAGAGCAGG No data
925973074_925973081 29 Left 925973074 2:9121269-9121291 CCATTGAAAAGCAGAAGAAACCT No data
Right 925973081 2:9121321-9121343 TGAGACTGACCCAGCAGAGCAGG No data
925973078_925973081 -3 Left 925973078 2:9121301-9121323 CCTTCTGCCCACAGGTCAGGTGA No data
Right 925973081 2:9121321-9121343 TGAGACTGACCCAGCAGAGCAGG No data
925973075_925973081 9 Left 925973075 2:9121289-9121311 CCTCATTCTCTGCCTTCTGCCCA No data
Right 925973081 2:9121321-9121343 TGAGACTGACCCAGCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925973081 Original CRISPR TGAGACTGACCCAGCAGAGC AGG Intergenic
No off target data available for this crispr