ID: 925973084

View in Genome Browser
Species Human (GRCh38)
Location 2:9121336-9121358
Sequence AGAGCAGGTGTGTCTTAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925973080_925973084 4 Left 925973080 2:9121309-9121331 CCACAGGTCAGGTGAGACTGACC No data
Right 925973084 2:9121336-9121358 AGAGCAGGTGTGTCTTAAGCAGG No data
925973078_925973084 12 Left 925973078 2:9121301-9121323 CCTTCTGCCCACAGGTCAGGTGA No data
Right 925973084 2:9121336-9121358 AGAGCAGGTGTGTCTTAAGCAGG No data
925973075_925973084 24 Left 925973075 2:9121289-9121311 CCTCATTCTCTGCCTTCTGCCCA No data
Right 925973084 2:9121336-9121358 AGAGCAGGTGTGTCTTAAGCAGG No data
925973079_925973084 5 Left 925973079 2:9121308-9121330 CCCACAGGTCAGGTGAGACTGAC No data
Right 925973084 2:9121336-9121358 AGAGCAGGTGTGTCTTAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925973084 Original CRISPR AGAGCAGGTGTGTCTTAAGC AGG Intergenic
No off target data available for this crispr