ID: 925973085

View in Genome Browser
Species Human (GRCh38)
Location 2:9121344-9121366
Sequence TGTGTCTTAAGCAGGTCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925973080_925973085 12 Left 925973080 2:9121309-9121331 CCACAGGTCAGGTGAGACTGACC No data
Right 925973085 2:9121344-9121366 TGTGTCTTAAGCAGGTCCCTCGG No data
925973078_925973085 20 Left 925973078 2:9121301-9121323 CCTTCTGCCCACAGGTCAGGTGA No data
Right 925973085 2:9121344-9121366 TGTGTCTTAAGCAGGTCCCTCGG No data
925973082_925973085 -9 Left 925973082 2:9121330-9121352 CCCAGCAGAGCAGGTGTGTCTTA No data
Right 925973085 2:9121344-9121366 TGTGTCTTAAGCAGGTCCCTCGG No data
925973083_925973085 -10 Left 925973083 2:9121331-9121353 CCAGCAGAGCAGGTGTGTCTTAA No data
Right 925973085 2:9121344-9121366 TGTGTCTTAAGCAGGTCCCTCGG No data
925973079_925973085 13 Left 925973079 2:9121308-9121330 CCCACAGGTCAGGTGAGACTGAC No data
Right 925973085 2:9121344-9121366 TGTGTCTTAAGCAGGTCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925973085 Original CRISPR TGTGTCTTAAGCAGGTCCCT CGG Intergenic
No off target data available for this crispr