ID: 925976635

View in Genome Browser
Species Human (GRCh38)
Location 2:9146499-9146521
Sequence TCCCCCTGGATTTCCTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925976628_925976635 -1 Left 925976628 2:9146477-9146499 CCTCACCCTCAAACCCACCTTCT No data
Right 925976635 2:9146499-9146521 TCCCCCTGGATTTCCTGTCCTGG No data
925976627_925976635 0 Left 925976627 2:9146476-9146498 CCCTCACCCTCAAACCCACCTTC No data
Right 925976635 2:9146499-9146521 TCCCCCTGGATTTCCTGTCCTGG No data
925976630_925976635 -7 Left 925976630 2:9146483-9146505 CCTCAAACCCACCTTCTCCCCCT No data
Right 925976635 2:9146499-9146521 TCCCCCTGGATTTCCTGTCCTGG No data
925976629_925976635 -6 Left 925976629 2:9146482-9146504 CCCTCAAACCCACCTTCTCCCCC No data
Right 925976635 2:9146499-9146521 TCCCCCTGGATTTCCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925976635 Original CRISPR TCCCCCTGGATTTCCTGTCC TGG Intergenic