ID: 925978962

View in Genome Browser
Species Human (GRCh38)
Location 2:9161663-9161685
Sequence CCATCGGAGTCCTCCTACGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925978951_925978962 24 Left 925978951 2:9161616-9161638 CCTGCAGAGTCACTGTCCAGGCT No data
Right 925978962 2:9161663-9161685 CCATCGGAGTCCTCCTACGAGGG No data
925978954_925978962 8 Left 925978954 2:9161632-9161654 CCAGGCTGCTGAGGACAGTTGGC No data
Right 925978962 2:9161663-9161685 CCATCGGAGTCCTCCTACGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925978962 Original CRISPR CCATCGGAGTCCTCCTACGA GGG Intergenic