ID: 925980134

View in Genome Browser
Species Human (GRCh38)
Location 2:9169903-9169925
Sequence GACTCAGATCTGCTGCCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925980134_925980140 1 Left 925980134 2:9169903-9169925 CCCAAGGGCAGCAGATCTGAGTC No data
Right 925980140 2:9169927-9169949 GAGGGCTGGGCATGAGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925980134 Original CRISPR GACTCAGATCTGCTGCCCTT GGG (reversed) Intergenic
No off target data available for this crispr