ID: 925984389

View in Genome Browser
Species Human (GRCh38)
Location 2:9204307-9204329
Sequence AAGGCGAAGAAAAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1785
Summary {0: 1, 1: 2, 2: 14, 3: 189, 4: 1579}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925984389_925984393 2 Left 925984389 2:9204307-9204329 CCTTCCTCCTTTTTCTTCGCCTT 0: 1
1: 2
2: 14
3: 189
4: 1579
Right 925984393 2:9204332-9204354 TTTTTAAAAAAAAATAATACAGG 0: 1
1: 6
2: 59
3: 641
4: 5006
925984389_925984395 30 Left 925984389 2:9204307-9204329 CCTTCCTCCTTTTTCTTCGCCTT 0: 1
1: 2
2: 14
3: 189
4: 1579
Right 925984395 2:9204360-9204382 AATCTCTTACTGAAACCCCAAGG 0: 1
1: 0
2: 2
3: 34
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925984389 Original CRISPR AAGGCGAAGAAAAAGGAGGA AGG (reversed) Intergenic
900254492 1:1690906-1690928 AAGGCAAATAAGAAGCAGGAAGG + Intronic
900263243 1:1744181-1744203 AAGGCAAATAAGAAGCAGGAAGG + Intronic
900491273 1:2950313-2950335 AGGGCATGGAAAAAGGAGGAAGG - Intergenic
900622548 1:3593934-3593956 AAGGGGAAGAGAAGGGATGATGG - Intronic
900681738 1:3920304-3920326 AAGACAAAGAAAAGGAAGGAAGG - Intergenic
900700782 1:4047487-4047509 AAGGGGAGGAAGGAGGAGGAAGG + Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901761006 1:11471617-11471639 AAGGAGAAGGAAGAGGAGAAGGG + Intergenic
902726698 1:18340953-18340975 AAGGAGAAGAAGGAGGGGGAGGG - Intronic
903225830 1:21893846-21893868 AAGGTGAAGAAAAAGGCAGAGGG + Intronic
903352488 1:22726188-22726210 GAGAAGGAGAAAAAGGAGGAAGG - Intronic
903445025 1:23417324-23417346 AAGGCAAAGAAGAAGGAAAAAGG - Exonic
903571143 1:24306380-24306402 ATGGGGAAGAGAAAGAAGGATGG + Intergenic
903690436 1:25169453-25169475 AAGGAGGAGAAAAGGAAGGAAGG + Intergenic
903965302 1:27085067-27085089 AAGGAGAAGAAAGAGAAGAAGGG - Intergenic
903986132 1:27230387-27230409 AAGGAGAAGAAAGAAGAAGATGG - Intergenic
904273474 1:29365359-29365381 AAGAAAAAGAAAAAGAAGGAAGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904577730 1:31516079-31516101 AAGGAAAGGAGAAAGGAGGAAGG - Intergenic
904821895 1:33250893-33250915 AAGGAGAAGAAGAAGGTGCATGG + Intergenic
904848831 1:33441526-33441548 AAGGAGGAGAAAGAGGAAGAAGG - Intergenic
905019784 1:34801071-34801093 AAGGCTCTGAAGAAGGAGGAAGG + Intronic
905260235 1:36712130-36712152 AAGGAGAAGAAAGAGGAGGAAGG - Intergenic
905566768 1:38971799-38971821 AAAGAAAAGAAAAAGGAGGCCGG + Intergenic
905718999 1:40179748-40179770 AAGGTGAAGAAAAAAGGGAATGG - Intronic
905970292 1:42136753-42136775 GAGAAGGAGAAAAAGGAGGAGGG - Intergenic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906647592 1:47486872-47486894 AAGGAAAAGAAAAAGCAGGAAGG - Intergenic
906708081 1:47909540-47909562 AAGGAGGAGAAGAAGGAAGAAGG + Intronic
907112129 1:51935791-51935813 AAGGGGAAGAGAACAGAGGAAGG + Intronic
907112773 1:51941404-51941426 AAGGAGAAGAGATAGGAGGCAGG + Intronic
907145492 1:52227019-52227041 AAGGGGTAGAAAATGGTGGAGGG + Intronic
907190505 1:52644265-52644287 AAGGCAAAAAAAAAGGAGAAAGG + Intronic
907492826 1:54819777-54819799 AAAGAGAAGAAAAGGAAGGAAGG - Intronic
907634162 1:56116829-56116851 CAGGTGAAGAAACAGCAGGAAGG + Intergenic
907736798 1:57121199-57121221 AAGGAGAAGAAGGAGAAGGAGGG + Intronic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
907920756 1:58909495-58909517 AAAGGGAAGAAGAAGGATGATGG + Intergenic
908436337 1:64110517-64110539 AAGCAGAAGAAAGATGAGGATGG - Intronic
908438036 1:64126126-64126148 CAGGTGAAGAAAAATGAGAATGG + Intronic
908632234 1:66121981-66122003 GAAAGGAAGAAAAAGGAGGAAGG - Intronic
908792985 1:67801902-67801924 AAGTGGAAGAAAAGGGAGGAAGG + Intronic
909294847 1:73934700-73934722 AAGGCAAAGAGAATGAAGGAGGG + Intergenic
909779060 1:79520066-79520088 GAGGAGGAGAAAGAGGAGGAAGG + Intergenic
909779082 1:79520191-79520213 GAGGAGGAGAAAGAGGAGGAAGG + Intergenic
910163294 1:84297551-84297573 AAGGAGAAGGAAAAGGCAGATGG - Intergenic
910164811 1:84315056-84315078 AAAGAGAAGAAAAAGAAAGAAGG - Intronic
910593552 1:88953885-88953907 AAGAAGAAGAAGAAGAAGGAGGG - Intronic
910767478 1:90796682-90796704 AAGAGGAACAAAAAGGAGCAGGG - Intergenic
910979507 1:92945229-92945251 AAGGCTATGATAAAGGAAGATGG + Intronic
911008756 1:93255780-93255802 AAGAGGAAGAAGAAGGAGGGGGG + Intronic
911058266 1:93726024-93726046 AAGAAGAAGAATAAGGAAGAGGG - Intronic
911070417 1:93827741-93827763 AAGGAGGAGAGAAAGGAGAAGGG + Intronic
911122740 1:94312327-94312349 AAAATGAAGAAGAAGGAGGAAGG - Intergenic
911431658 1:97796646-97796668 AAGGGAAAGACAAAGAAGGAGGG + Intronic
911489134 1:98540701-98540723 CAGGCTAAGAAACAGGTGGATGG - Intergenic
911620921 1:100065732-100065754 AAGGGGAAGAGAAAAGGGGAAGG - Intronic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
911988092 1:104657342-104657364 GAGGAGAAGAAAAAGTAGGGAGG - Intergenic
912088495 1:106040284-106040306 AAAGAAAAGAAAAAGAAGGAAGG + Intergenic
912127382 1:106555585-106555607 AAGGGGAAGAAAGAGTGGGAAGG + Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912355121 1:109048505-109048527 AAGGGAAAGAAAAGGAAGGAAGG + Intergenic
912509522 1:110179505-110179527 AAGGGGAAGGGAAAGGAAGAAGG - Intronic
912571512 1:110627661-110627683 AAGGAAAACAAAAAGGAAGAAGG + Intronic
912913475 1:113787534-113787556 AAGGTGAGGAAAAAGGAGCATGG - Intronic
913705641 1:121419432-121419454 AAGGAAAGAAAAAAGGAGGAAGG - Intergenic
913940315 1:125097714-125097736 AAAGAGAAGAGAAAGGAAGATGG - Intergenic
913963694 1:143357590-143357612 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915271324 1:154755817-154755839 AAGAAGAAGAAGGAGGAGGAGGG + Intronic
915494886 1:156274983-156275005 AAGGCTTCCAAAAAGGAGGAAGG + Intronic
915616409 1:157042951-157042973 GAGGCCAACAGAAAGGAGGAAGG + Intronic
915762431 1:158328944-158328966 AAGGCATAGCAAAAGGAGCAAGG + Exonic
915797640 1:158753441-158753463 AAGTAGAAGTAAAAGGAGGTTGG - Intergenic
915805880 1:158849196-158849218 AAGGCCAAGAAAAACAAGGAAGG + Exonic
915954918 1:160213489-160213511 AAGGGGGAGGAAGAGGAGGAAGG + Exonic
916047703 1:161013143-161013165 AAAAAGAAGAAAGAGGAGGAGGG + Intronic
916189931 1:162168721-162168743 AAGGAGAAAGAAAGGGAGGAAGG - Intronic
916223152 1:162464578-162464600 AAGGGGAACCTAAAGGAGGAGGG - Intergenic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916474235 1:165153345-165153367 CAGGTGAAGAAAAAGGATGGTGG + Intergenic
916616266 1:166444252-166444274 AAGGAGAAGAAGAAGAAGAAAGG + Intergenic
916651104 1:166835567-166835589 AAGCAGAAGAAGGAGGAGGAAGG - Intergenic
916802943 1:168231611-168231633 AAGGAAAAGACAGAGGAGGAAGG - Intronic
918204457 1:182296842-182296864 AAGATGAAGAAATAGGAGAAGGG - Intergenic
918625609 1:186653127-186653149 AAGCCAAAGAAAAAGGGTGAGGG - Intergenic
918730152 1:187983021-187983043 AAGGAGAACAAGAAGGATGAAGG + Intergenic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919038183 1:192343946-192343968 AAGTTGGAGAAAAAAGAGGATGG - Intronic
919094205 1:193010356-193010378 AAGGGGAAGAAGAAGAAAGAAGG + Intergenic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
919267292 1:195286263-195286285 AAGAAGGAGAAAAGGGAGGAAGG - Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919586021 1:199441396-199441418 AAGGAGTAAAAAAAGGAAGAAGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919667811 1:200309363-200309385 AATGAGGACAAAAAGGAGGATGG - Intergenic
919670167 1:200331009-200331031 AGGCCGGAGAAAAAGGAGGCAGG + Intergenic
919868531 1:201802482-201802504 AAAGAAAAGAAAAAGGAGGCCGG + Intronic
919913630 1:202127061-202127083 GAGGCAAAGAACAAGGGGGAAGG + Intronic
920189222 1:204181775-204181797 AAGGAGAAGAGAAAAGAGGAAGG - Intergenic
920274788 1:204796087-204796109 AAGGCAAAGAAAACTGAAGAAGG + Intergenic
920521254 1:206628700-206628722 AAGGAGAAGAAGAAGAAGAAAGG + Intergenic
920893503 1:210018835-210018857 AAGGTATAGAAAAAGGGGGAAGG + Intronic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921397055 1:214679620-214679642 AAGGAGAAGAAGAAGAAGAATGG - Intergenic
921687026 1:218101735-218101757 CAGGGGAAGGAAAAGGAGAAAGG + Intergenic
921898695 1:220427722-220427744 AAGGCAAAGAAAATGAAGCATGG + Intergenic
922004659 1:221517615-221517637 AAGACAATGAACAAGGAGGAGGG + Intergenic
922098638 1:222463921-222463943 AAAGAGCAGAATAAGGAGGATGG + Intergenic
922150187 1:222995185-222995207 ATGGGAAAGAAAAAGGAAGATGG - Intronic
922165131 1:223108955-223108977 AAAACGAAGAAAACGTAGGATGG + Intergenic
922213263 1:223501200-223501222 GAGGGAAAGGAAAAGGAGGAGGG - Intergenic
922213488 1:223502640-223502662 TAGGCGGACGAAAAGGAGGAAGG + Intergenic
922292883 1:224223388-224223410 AAGGCAAAGAAGATGAAGGAAGG - Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
922936290 1:229425707-229425729 AAGGAGAAGAAAGAGGAGGAGGG + Intergenic
922936332 1:229425902-229425924 AAGGAGGAGGAAGAGGAGGAGGG + Intergenic
922975064 1:229777631-229777653 AAGGGGAAGCAACAGGAAGAGGG + Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923072437 1:230577889-230577911 AAGGAGAAGAAGAAGGAGAAGGG - Intergenic
923378675 1:233392648-233392670 AAGGAGAAGGAAAAGGAAAAGGG - Intergenic
923436943 1:233976083-233976105 AAGGCGAAGGAGGAGGAGGGAGG + Intronic
924012827 1:239684795-239684817 AAGGAAAAGAAAAGAGAGGATGG + Intronic
924628773 1:245717193-245717215 ATAGGGAGGAAAAAGGAGGATGG + Intergenic
924947449 1:248855951-248855973 AAGGAGAACAAAGAGGAAGATGG + Intronic
1063286119 10:4690482-4690504 AAAGGGAAGAAAAATGAGGCAGG + Intergenic
1063426248 10:5952314-5952336 AAGGAGGAGAAAGAGTAGGAAGG - Intronic
1063874752 10:10462453-10462475 AAGGCAAAGAAGAAGCAGGGTGG - Intergenic
1063923110 10:10951143-10951165 AAAGAAAAGAAAAAGGAGGATGG - Intergenic
1063938942 10:11107803-11107825 AGGGGGAAGAAGAGGGAGGAGGG - Intronic
1064003528 10:11682675-11682697 AAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1064165131 10:12979342-12979364 AAGGGAAAGAACAAGCAGGAGGG - Intronic
1064494232 10:15890976-15890998 GAGACAAAGAAAAAGGAGGAAGG + Intergenic
1064695505 10:17961198-17961220 AAGGCTAAGAGAAGGAAGGAGGG + Intronic
1064993259 10:21274938-21274960 GAGGAGAAGGAAGAGGAGGAGGG + Intergenic
1065002296 10:21348050-21348072 CAGGTGAAGAAAAATGATGATGG - Intergenic
1065102282 10:22342042-22342064 AAAGCGAAGAATAGGGAGTAAGG + Intergenic
1065121133 10:22531325-22531347 AAGGGGGAGAAAGAGGGGGAGGG + Intergenic
1065279275 10:24117984-24118006 AAAGCCAAGAAAGGGGAGGAGGG + Intronic
1065318506 10:24487115-24487137 AGGGAGAAGAAGAAGGAGAAGGG - Intronic
1065340852 10:24703721-24703743 AAGTCGCAGAAAAGGCAGGATGG - Intronic
1065374865 10:25028500-25028522 AAGTTGAAGAAACAAGAGGAAGG - Intronic
1065382868 10:25107604-25107626 AATGGGAAGAACAAGCAGGAAGG - Intergenic
1065742027 10:28805672-28805694 CAGGGCAAGAAAAAGGAGTAGGG - Intergenic
1065850113 10:29780792-29780814 AAGGAAAAGAAAAAGGAAAAAGG - Intergenic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1066369203 10:34805980-34806002 AAGACAAAAAAAAAGGAAGAAGG + Intronic
1067168895 10:43888468-43888490 AAGGAAAAGAGAAAGAAGGAAGG - Intergenic
1067561411 10:47307295-47307317 GAGGGGAAGAAAAGAGAGGAGGG + Intronic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068220762 10:54042691-54042713 AAGGCTATGAAAAAGGAGTTTGG + Intronic
1068688662 10:59894300-59894322 AATGCCGAGAAAAATGAGGATGG - Intronic
1068803751 10:61171660-61171682 AAACTGAAGAAAAATGAGGAGGG + Intergenic
1068830661 10:61491198-61491220 AAGGAGAAGGGAAGGGAGGAAGG + Intergenic
1068949001 10:62758724-62758746 AAGGCTCAGAAACAGGAGAAAGG - Intergenic
1069022230 10:63501904-63501926 AAGGCGAGAAGAAAGGAGGCAGG + Intergenic
1069588872 10:69630023-69630045 AAGAAGGAGAAGAAGGAGGAGGG - Intergenic
1069667762 10:70175049-70175071 AAGCCCAAGAAAAAGGCTGAAGG - Intergenic
1070444615 10:76484153-76484175 GAGAGGAAGAAGAAGGAGGATGG - Intronic
1070615559 10:77966940-77966962 AAAGGGAAGAAAAGGAAGGAAGG - Intergenic
1071024559 10:81097465-81097487 GAGGGAAAGAATAAGGAGGAAGG - Intergenic
1071047511 10:81400184-81400206 AGTGGGAAGAAAAGGGAGGAAGG + Intergenic
1071106333 10:82100364-82100386 AAGGCTGAAAAAAAGGAAGAGGG - Intronic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071124953 10:82323012-82323034 AAGGAGAAGAAAAAGGAAAAAGG + Intronic
1071156050 10:82690966-82690988 AAGAAGGAGAAAGAGGAGGAAGG - Intronic
1071291765 10:84194164-84194186 AAGGCAAAGAGAAAGGGTGATGG - Intergenic
1071298691 10:84240976-84240998 AAAGAGAAGAAAAAGCAGTAAGG + Intronic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071423777 10:85528121-85528143 AAAGCAAAGAAAGAGGGGGATGG + Intergenic
1071732451 10:88262002-88262024 AGGGTGAAGAATAAGGAGAAAGG + Intergenic
1071807737 10:89142760-89142782 AAGGAGAAGAGAAAGGAGAAGGG + Intergenic
1071991685 10:91105754-91105776 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1072456909 10:95584460-95584482 AAGGAGTAGAACAAGGAGTATGG - Intergenic
1072645464 10:97251111-97251133 AAGGGGAAGAGAAAGGGGAAGGG + Intronic
1072811707 10:98467500-98467522 AAGGGGGAGAGAAAGGAGGAGGG + Intronic
1072857119 10:98959879-98959901 AAGGAGAAAGAAGAGGAGGAGGG - Intronic
1072875891 10:99172884-99172906 AAGAAGAAGAAAAAGAAGAAAGG + Intronic
1072916013 10:99537622-99537644 AGGAGGAAGAAAAAGAAGGAGGG + Intergenic
1073021561 10:100448968-100448990 AAGGAGAAGAAAGAAGAAGAAGG + Intergenic
1073056759 10:100708047-100708069 AAGGAGAAGGAAGGGGAGGACGG + Intergenic
1073146556 10:101285378-101285400 GAGGGGATGAAAATGGAGGATGG - Intergenic
1073451692 10:103613395-103613417 CAGGCAAAGAAAAAGGAGCATGG - Intronic
1073643299 10:105274608-105274630 AAGGGGAAGAGAAAGAAGCATGG - Intergenic
1073855266 10:107666241-107666263 GAGGAGGAGAAAGAGGAGGAGGG - Intergenic
1073857798 10:107697494-107697516 AGGAGGAAGAAAAAGAAGGAAGG - Intergenic
1073985188 10:109200154-109200176 AAAGTGAAGAACAAAGAGGAAGG + Intergenic
1074201796 10:111243967-111243989 AAGGAAAAGAAAAATGAGGGAGG + Intergenic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1074758800 10:116648495-116648517 AAGAAGAAGAAAAAGAAGGAAGG + Intergenic
1075475529 10:122730511-122730533 AAGGTGTAGAATCAGGAGGAGGG + Intergenic
1075591503 10:123694687-123694709 AAGGAAAAGAAAAAGAAGGAAGG + Intergenic
1075844665 10:125535632-125535654 AGGAAGAAGAAAAGGGAGGAAGG - Intergenic
1076192562 10:128492968-128492990 AAAGAGATGAAAAAGGTGGAGGG + Intergenic
1076448879 10:130541472-130541494 AAGGAGAAGAAAAAGAGGGGAGG - Intergenic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1076640316 10:131911523-131911545 AAGGGAAAGAAAAAGGAAAAAGG - Intronic
1077030092 11:461633-461655 CAGGCTCAGAAAAAGGGGGAAGG - Intronic
1077392592 11:2306993-2307015 GAGGAGAAGAAAGAGGGGGAGGG + Intronic
1077600792 11:3573114-3573136 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1077787624 11:5401836-5401858 AAGCAGAAGAAAAAGAGGGAAGG - Intronic
1077955778 11:7019097-7019119 AAGAGGAACACAAAGGAGGAAGG - Intronic
1078011282 11:7574971-7574993 AAGGGACAGAAAAGGGAGGAAGG - Intronic
1078135795 11:8650450-8650472 GAGCAGAAGGAAAAGGAGGAAGG + Intronic
1078155593 11:8797447-8797469 AAGGGGAAGAAGGAGGAAGAAGG - Intronic
1078155595 11:8797457-8797479 AAGGGGAAGAAAGGGGAAGAAGG - Intronic
1078156640 11:8805627-8805649 TAGGCTGGGAAAAAGGAGGAGGG - Intronic
1078362545 11:10680447-10680469 AAGGGAAAGAGAAAGAAGGAAGG + Intronic
1078468146 11:11565524-11565546 GAGCAGAAGAAAAAGGAGGCTGG + Intronic
1078524778 11:12091904-12091926 AGGGAGGAGAAAAGGGAGGAAGG - Intergenic
1078562559 11:12385905-12385927 ATGGGGAATAAAATGGAGGATGG - Intronic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1079134646 11:17769503-17769525 AAGGAGAAAGGAAAGGAGGAAGG + Intronic
1079445567 11:20553668-20553690 AGGAGAAAGAAAAAGGAGGAAGG - Intergenic
1079810946 11:24999353-24999375 AAGGAGGAGGAAGAGGAGGAAGG + Intronic
1080266415 11:30406514-30406536 AAAGCAAAGTAAGAGGAGGAAGG + Intronic
1080603219 11:33841337-33841359 AAGGAAAAGGGAAAGGAGGAGGG - Intergenic
1080791184 11:35524109-35524131 AAGGCGAAGATGAAGTAGGGAGG + Intronic
1081006638 11:37752692-37752714 AAGGGAAAGAGAAAGAAGGAAGG - Intergenic
1081060593 11:38470572-38470594 AGGATGAAGAAAAAGGAGGAGGG - Intergenic
1081355182 11:42103741-42103763 AAAGGGAAGAAAAAGGGAGAGGG - Intergenic
1081659487 11:44879267-44879289 TAGGGAAAGAAGAAGGAGGAAGG - Intronic
1081927762 11:46845177-46845199 AGGGTGATGAAAATGGAGGAAGG + Intronic
1082721820 11:56687139-56687161 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1082849876 11:57754931-57754953 AAGAAGAAAAAAAAGAAGGAAGG - Intronic
1082892401 11:58154095-58154117 AAGGGGAGGAGGAAGGAGGAGGG + Intronic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1082892430 11:58154195-58154217 AAGGGGGAGGAGAAGGAGGAAGG + Intronic
1083328812 11:61887365-61887387 AAGGGTAAGAGAAGGGAGGATGG - Intronic
1083516857 11:63267941-63267963 AAGAAGAAGAAAAAAGAAGAAGG - Intronic
1083650445 11:64200724-64200746 AAAACAAAGAAAAAAGAGGAAGG - Intronic
1083830875 11:65232826-65232848 AAAGAGAAGAAGATGGAGGAAGG - Intergenic
1084005512 11:66321378-66321400 AAGGAGAAGAAAGAAGGGGAAGG + Intergenic
1084164003 11:67366751-67366773 CAGGGAAAGAAAAGGGAGGAGGG - Intronic
1084256712 11:67947699-67947721 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084791478 11:71477780-71477802 GAGGCCAACACAAAGGAGGATGG - Intronic
1084792505 11:71483469-71483491 CAGGGGAAGAGAAAGGAGGAGGG - Intronic
1084816078 11:71647675-71647697 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1084887022 11:72217373-72217395 AAGGGGAAGAAATTGGAAGAGGG + Intronic
1085224846 11:74910567-74910589 AAAGTGAAGAGAAAGGAGGATGG + Intronic
1085863501 11:80261100-80261122 AAGGAGAGGAAAAAGAAGGCAGG - Intergenic
1085909999 11:80812041-80812063 AAGGAGAAAAAAAAAGAGAAAGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086156461 11:83672157-83672179 AAGGGGAAGAAAGGGAAGGAAGG - Intronic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1087068101 11:94046400-94046422 AAGGGAAAGAAAAAGCATGAAGG - Intronic
1087324885 11:96709679-96709701 AAGAAGAAAAGAAAGGAGGAAGG - Intergenic
1087726678 11:101725989-101726011 AAGGAAGAGAATAAGGAGGAAGG + Intronic
1087968402 11:104448773-104448795 AAGGAGAGGAAAAAGGAAGATGG + Intergenic
1087981124 11:104615931-104615953 AAAGAAAAGAAAGAGGAGGAAGG - Intergenic
1087995233 11:104797969-104797991 AAGGCCACGATAAAGGAGTATGG + Intergenic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088115235 11:106305174-106305196 AAGGGGAAGAAAAAAGACAAGGG + Intergenic
1088136792 11:106565161-106565183 AACTGGAAGAGAAAGGAGGAAGG + Intergenic
1088268528 11:108009872-108009894 AACACGCAGAAAAGGGAGGAAGG - Intronic
1088448351 11:109955570-109955592 AAGCAGGACAAAAAGGAGGAGGG + Intergenic
1088466731 11:110147701-110147723 AAGGGGAGGCAAAAGGAGTAAGG - Intronic
1088512504 11:110592651-110592673 AGGAGGAAGAAAAAGGAAGAAGG + Intronic
1088579277 11:111299799-111299821 AAGGCGGAGAAAAGGGACGAGGG + Intronic
1088622024 11:111694811-111694833 AAGGGGAAGAGAAATGAAGAGGG - Intronic
1088686967 11:112292259-112292281 AAGGGGAAGAGAAGGGAGGGAGG - Intergenic
1089248409 11:117138851-117138873 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
1089476934 11:118771611-118771633 AGGGAGAAGGCAAAGGAGGAAGG + Intronic
1089593768 11:119561554-119561576 GAGGGGAAGGAAAAAGAGGAAGG - Intergenic
1089965888 11:122655079-122655101 AAGGGAAAAAGAAAGGAGGAAGG - Intergenic
1090145127 11:124313175-124313197 AAAGGAAAGAAAAAGAAGGAAGG + Intergenic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090628506 11:128626381-128626403 AAGGAGAAGAAAAAGAATTAAGG + Intergenic
1090634904 11:128685063-128685085 AAGGGAAAGAGAAAGGAAGAGGG + Intergenic
1090892710 11:130940398-130940420 AAGGAGAAGAACAAGGTGGAAGG + Intergenic
1090924865 11:131240581-131240603 AAGACAAAGAAAACGGATGAAGG + Intergenic
1090935481 11:131338076-131338098 AATGTGAAGAAAAAAGAAGAGGG - Intergenic
1091192652 11:133707595-133707617 AAAGGGAAGAAAAAAGGGGAAGG + Intergenic
1091535383 12:1403200-1403222 AGGGGGAAAAAAAAGGAAGAAGG - Intronic
1091845128 12:3649860-3649882 AAAAGGAAGAAAAAAGAGGAAGG + Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1091930147 12:4389416-4389438 AAGGAGAAGAAACAGAGGGAGGG - Intergenic
1092201263 12:6585245-6585267 AAGACCAAGAAAAAGAAGGGAGG + Intronic
1092426926 12:8382372-8382394 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1092527741 12:9319496-9319518 AAGTTGAAGAGGAAGGAGGACGG - Intergenic
1093106016 12:15088035-15088057 AAGGAAAAGAGAAAGCAGGAGGG + Intergenic
1093145985 12:15567433-15567455 AAGGAGAAGAAAAAGAAAGCTGG - Intronic
1093398107 12:18708154-18708176 AGGGAGAAGAAAATGGAGAAAGG - Intronic
1093643059 12:21550638-21550660 AAGACAAAGAAAAAGGAGACAGG + Intronic
1094071051 12:26413032-26413054 AAGGGTGAGAAACAGGAGGATGG + Intronic
1094355492 12:29573501-29573523 AGGGTGAAGAAGTAGGAGGAGGG + Intronic
1094469027 12:30785580-30785602 AAGGAGAAAAAAAAAGAGGCTGG + Intergenic
1094499988 12:31012543-31012565 AAGTTGAAGAGGAAGGAGGACGG - Intergenic
1095272608 12:40237517-40237539 AATGAGAAGAGAAAGGAGGGTGG + Intronic
1095275910 12:40282142-40282164 AAGGGGAAGAGAAAGGAGAAGGG - Intronic
1095284513 12:40392394-40392416 AAGGGGAAGAAAAAGGCTGTTGG + Intergenic
1095298840 12:40558766-40558788 AAGGCAAAGAAGAATGAGGTAGG - Intronic
1095404187 12:41849511-41849533 TAGGCAAAGAAGAAGGAGGTGGG - Intergenic
1095959248 12:47823677-47823699 GAGTGGAAGAAAAAGAAGGAAGG + Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096122433 12:49097034-49097056 AAGGGGAAGGAAAAGGATGGTGG + Exonic
1096451035 12:51741545-51741567 AAGGGGAAGACAAGGAAGGAAGG - Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096553474 12:52389442-52389464 ACAGAGAAGAAAAGGGAGGAAGG - Intergenic
1096828873 12:54299554-54299576 CAGGCTAAGAGTAAGGAGGATGG - Intronic
1096921250 12:55088044-55088066 AAGCTGGAGAAGAAGGAGGATGG + Intergenic
1096954905 12:55516317-55516339 AAGGGGAGGAAAAAGTGGGAAGG + Intergenic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1097237886 12:57552130-57552152 AAGGCTGAGAAACAGGAGGAGGG + Intronic
1097561391 12:61210391-61210413 AAGGGGAAGAAACAGGACTACGG - Intergenic
1097852211 12:64423449-64423471 AAAGCAAAAAAAAAGGAGGGGGG - Intronic
1098017713 12:66123911-66123933 AAGGCAAAGAAAAAGGCTGAAGG - Exonic
1098102378 12:67031705-67031727 TAGGCAAATAAAAAAGAGGAAGG - Intergenic
1098256092 12:68616937-68616959 AAGGCAAAGAAAAAGGAAACAGG - Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098805413 12:75015954-75015976 AAAGGGAAAAAAAAGGAGGAGGG + Intergenic
1099051401 12:77785465-77785487 AAGGTGAAGAAGTAGGAGGAGGG + Intergenic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1099163857 12:79277014-79277036 AAGAGGAAGAAGAAGGAGAAGGG + Intronic
1099356606 12:81645208-81645230 AAGGAGAAGAAAGAGAAAGAAGG + Intronic
1099531728 12:83790319-83790341 ATGGCGAAAAAAAAGGTGGGGGG - Intergenic
1099907855 12:88793080-88793102 AAGGAGAAAAGAACGGAGGAAGG - Intergenic
1100550731 12:95644353-95644375 AAGGAGAAGAAGAAGGGGCAAGG - Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100550742 12:95644399-95644421 AAGGGGGAGAAGAAGGGGGAAGG - Intergenic
1100673572 12:96842745-96842767 GAGAAGAGGAAAAAGGAGGAAGG - Intronic
1100863308 12:98830122-98830144 AAGGGGAAGGAAAAAGAGCAGGG + Intronic
1100872135 12:98921154-98921176 AAGAAGAAAAGAAAGGAGGAAGG - Intronic
1101302883 12:103499516-103499538 ATGGAGAAGAGAAAGGAAGATGG + Intergenic
1101446861 12:104742800-104742822 GAGGCCAAGAAACAAGAGGAGGG - Intronic
1101843203 12:108342277-108342299 AAGAGGAAGAAAGGGGAGGAGGG + Intergenic
1102275650 12:111580178-111580200 AATGGGAAGAAAGAGGAGGCTGG + Intronic
1102397979 12:112603787-112603809 AGGGCGAAGAAAAATGAGACTGG - Intronic
1102521211 12:113478407-113478429 TAGGCTAACAAAAAGGAGGTGGG - Intergenic
1102536761 12:113587697-113587719 AAGGAGAAGGAAAAGGAGTGGGG - Intergenic
1102544100 12:113642312-113642334 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1102673574 12:114640629-114640651 AAAGGGAAGAAAAGGAAGGAAGG - Intergenic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102733541 12:115136712-115136734 AAGATGAAGAAGAAGGAGCAAGG + Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103074111 12:117968611-117968633 AAGGAGGAGAGAGAGGAGGAGGG + Intronic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103256038 12:119542334-119542356 AAGAAGAAGAAAAAGGACAAAGG + Intergenic
1103366999 12:120390709-120390731 AAGGAGAAGGAAAGGAAGGAAGG + Intergenic
1103862931 12:124028595-124028617 AGGGCCAAGCAAAAGCAGGAGGG + Intronic
1103915099 12:124372133-124372155 AAGGCAGAGAAGAAGGAGGGCGG - Exonic
1104006147 12:124893940-124893962 AAGAAAAAGAAAAAGCAGGAAGG + Intergenic
1104103089 12:125634151-125634173 AAGGCGAAGGAAGAGGGGGAAGG - Intronic
1104159374 12:126163759-126163781 AGGAAGAAGAAAAAGGAGGAGGG + Intergenic
1104559651 12:129832257-129832279 AAGGAGAGGAAAAAGGGGGAGGG + Intronic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1104781261 12:131422032-131422054 AGGCAGGAGAAAAAGGAGGAGGG - Intergenic
1104783777 12:131437147-131437169 AAGGAGAGGAAACAGGTGGAGGG - Intergenic
1105205368 13:18218831-18218853 AAGGCAAAGAAACAGGAGCAAGG - Intergenic
1105309457 13:19193266-19193288 AAAGGGCTGAAAAAGGAGGAGGG + Intergenic
1105528142 13:21194840-21194862 AAAGGGCTGAAAAAGGAGGATGG - Intergenic
1105782053 13:23714352-23714374 CAGGAGAAGAAAAAAGAGGTTGG - Intergenic
1105826202 13:24125718-24125740 GAGGTGAGGAATAAGGAGGAGGG + Intronic
1105834159 13:24193582-24193604 AAGGGGCAGGAACAGGAGGAAGG + Intronic
1105892723 13:24693355-24693377 ATGGAGAGGAAAAGGGAGGAAGG - Intronic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1106044305 13:26123488-26123510 AAGGGAAAGAAAATGGAGGCTGG + Intergenic
1106525750 13:30539856-30539878 GAGGAAAAGAAAAAGAAGGACGG - Intronic
1106828842 13:33556249-33556271 AAGGAAAAGAAAAGGGAGGCGGG - Intergenic
1106849597 13:33775302-33775324 GAGGGGAAGAAAAAAAAGGAGGG - Intergenic
1107659185 13:42621750-42621772 AAGCAGAAGAGAAAGGAGGAAGG + Intergenic
1107758485 13:43651240-43651262 AAGAGGAAGAAAAAGGAAGAGGG + Intronic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1107842596 13:44474662-44474684 AAGAGGAAGAGAAAGGATGAAGG + Intronic
1107878013 13:44807397-44807419 AAGGAGAAGAAAATGGCGGGGGG + Intergenic
1108051528 13:46445763-46445785 AAAGAGAAGAAAAAGGAAGTTGG + Intergenic
1108068942 13:46607624-46607646 AAGAAGAAGGAAGAGGAGGAAGG - Intronic
1108097343 13:46917358-46917380 TGGGGGAAGAAAAAGGAGGGAGG - Intergenic
1108331688 13:49391316-49391338 AGGGGGAAGAGAAAGGAAGATGG + Intronic
1108470832 13:50765431-50765453 AAGGAGAAAGAAGAGGAGGAAGG + Intronic
1108698944 13:52927307-52927329 AAGGAGGAAGAAAAGGAGGAAGG - Intergenic
1108794814 13:54017974-54017996 AGGGAGAAGAAAAGGAAGGAAGG + Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1108899771 13:55387442-55387464 AAGGAAAAGAAACAGGATGAGGG + Intergenic
1108954967 13:56141773-56141795 AAGGTGGAGAAAAGGGAGCATGG - Intergenic
1109086445 13:57977875-57977897 AAGGCTAAGAAAATGGAGGATGG + Intergenic
1109132084 13:58599968-58599990 AAAGAGAAGAAACATGAGGATGG - Intergenic
1109264017 13:60175937-60175959 AAAGCTAGGAAAATGGAGGAAGG - Intergenic
1109544081 13:63819388-63819410 AAAGAGAAGAAAAAGGAAGTTGG + Intergenic
1109971725 13:69779344-69779366 AAGGAAAGGAAAAAAGAGGAGGG - Intronic
1110329331 13:74252761-74252783 ATGGGGAAGAGAAGGGAGGATGG - Intergenic
1110465551 13:75796812-75796834 AAGGAGAAGAAAAAGAAGAGAGG - Intronic
1110526290 13:76542031-76542053 AAGCCGAAAACAAAGGAGTAGGG + Intergenic
1110564712 13:76946644-76946666 AAGGAGAAGAAAAAGGTAGAAGG + Intergenic
1110665766 13:78115993-78116015 AAGGAGAAGAAAAAGCAAAAGGG - Intergenic
1110717306 13:78720976-78720998 TAGGGGAAGGAAAAGAAGGAGGG + Intergenic
1110744428 13:79036360-79036382 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1110870219 13:80443539-80443561 AAGGAGGAGAAAAAGAAGAAAGG - Intergenic
1110904441 13:80867860-80867882 AAGGAGAAAATAAAGGAGAATGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1112560297 13:100506772-100506794 TAGGAGGAGAAAAAGGAAGAGGG + Intronic
1112603091 13:100876272-100876294 AAAGAAAGGAAAAAGGAGGAAGG - Intergenic
1112618818 13:101034405-101034427 AAGGGGAAGGAAGAGCAGGAAGG - Intergenic
1112630895 13:101160299-101160321 AAAGCGAAAAAGAAGGAAGAGGG - Intronic
1112643170 13:101300299-101300321 AAGAGGAAGAAGAAGAAGGAGGG - Intronic
1112643175 13:101300331-101300353 AAGAAAAAGAAAAAGAAGGAAGG - Intronic
1113093412 13:106638019-106638041 AAGACCAAGAAAAAAGAGAATGG - Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113374147 13:109748568-109748590 AAGGTGGGGAAAAAGGAGAAAGG + Intergenic
1113613296 13:111663323-111663345 AAGGTGAGGAAGAAGGAGGAGGG - Intronic
1113613312 13:111663395-111663417 AAGGCGAGGAAGAAGGACGAGGG - Intronic
1113754784 13:112803828-112803850 AAGGAGAGGAAGGAGGAGGAGGG - Intronic
1114257296 14:21014297-21014319 AAAGAGAAGGAAAAAGAGGAAGG + Intergenic
1114490752 14:23100259-23100281 AAGAAGAAGAAAAAGGTGGGGGG + Exonic
1114637135 14:24194208-24194230 AAGGCCTAGAAAAAGGAGAGCGG + Intronic
1114739532 14:25081051-25081073 AAAGAAAAGAAAAAGAAGGAAGG - Intergenic
1114931113 14:27467828-27467850 AAGGAGAAGAAACAGGCAGAGGG + Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115421474 14:33199706-33199728 GAGGGGAAGAAGAAGGGGGAGGG - Intronic
1115440579 14:33430251-33430273 AAGGCGGAGGAAAAGAAGAATGG - Intronic
1115467110 14:33727623-33727645 AAGAAAAAGAAAAAGAAGGAAGG + Intronic
1116201248 14:41799952-41799974 AAGGGAAAGAAAAAGGAAAAGGG + Intronic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116688544 14:48074782-48074804 AAGGAGACTAAAAAGAAGGAAGG - Intergenic
1116905621 14:50400799-50400821 TAGCCTAAAAAAAAGGAGGAAGG - Intronic
1117008024 14:51442294-51442316 AAGAGAAAGAGAAAGGAGGAGGG - Intergenic
1117237741 14:53796662-53796684 ATGGCAAAGAAAATGGAGGACGG - Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117390984 14:55262511-55262533 TAGCTGAAGAAACAGGAGGATGG - Intergenic
1117506725 14:56411757-56411779 AAGGAGAAGAAGAAGAAGAACGG + Intergenic
1117667837 14:58076070-58076092 AAGGAGGAGAAAGAGGAGGAAGG + Intronic
1117959666 14:61150197-61150219 AAAGAAAAGAAAAAGAAGGAGGG - Intergenic
1118186374 14:63542549-63542571 AAGGTGGAGAAAAAGGGGGGAGG + Intronic
1118382097 14:65225808-65225830 AAGGTGAAGACAAAGGAGACTGG + Intergenic
1118451563 14:65907127-65907149 AGGGCGAAGGAAAAGAGGGAAGG + Intergenic
1118487750 14:66229860-66229882 CAGGTGAAAAAAAAGAAGGAAGG - Intergenic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118563727 14:67116332-67116354 AAGGAAAAGAAAAAGGGGAAGGG + Intronic
1118612724 14:67554117-67554139 AAGGAGAAAAAAATGGATGAGGG + Intronic
1118647745 14:67856149-67856171 AAAGAGCAGAAAAAGCAGGAGGG - Intronic
1118815287 14:69308051-69308073 AAGGAGAGGAAAGTGGAGGAGGG - Intronic
1119041514 14:71278711-71278733 AGGGAGAAGAAAAGAGAGGAAGG + Intergenic
1119300126 14:73565368-73565390 AAGGAAAAGAAAAAGGGAGAGGG - Intergenic
1119964809 14:78902532-78902554 AAGGAGATGAAGGAGGAGGAAGG + Intronic
1120046675 14:79815565-79815587 AAGGCGAAGAAAGAGGAGGAGGG + Intronic
1120091527 14:80337700-80337722 AGAGAGAGGAAAAAGGAGGAAGG + Intronic
1120162592 14:81161828-81161850 AAAGAAAATAAAAAGGAGGAGGG + Intergenic
1120242976 14:81971611-81971633 AAGAAGAAGAAAAAGAAGGAAGG - Intergenic
1120366737 14:83580956-83580978 AAGGGCTAGAAAAATGAGGAAGG - Intergenic
1120388129 14:83871237-83871259 AAGGGGGAGAAGAAGGAGGAAGG + Intergenic
1120519310 14:85508202-85508224 AAGGAAAGGAGAAAGGAGGACGG + Intergenic
1120613232 14:86668603-86668625 AAGGAAAAGAAAAAGGAAGAGGG - Intergenic
1120815675 14:88855274-88855296 AAGGAGATGAAAAATGAAGAAGG - Intronic
1120880811 14:89413979-89414001 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1120904923 14:89611946-89611968 GGGGGGAAGAAAAAGCAGGATGG - Intronic
1121038618 14:90727049-90727071 AAGGAGAAGAAAAAGAGGGGTGG + Intronic
1121067660 14:90983644-90983666 AAGAAAAAGAAAAAGGAAGAAGG + Intronic
1121074977 14:91060421-91060443 AAGGAGAAGATGGAGGAGGAGGG - Exonic
1121144207 14:91569434-91569456 AAGGAGGAGGAAAAAGAGGAAGG - Intergenic
1121167147 14:91814541-91814563 AAATCAAAGAAAAAGAAGGATGG + Intronic
1121310469 14:92932807-92932829 GAGGAGAAGAAAGAGGAGGAGGG + Exonic
1121593270 14:95137180-95137202 AAGGAGAAGGAAAAGGGGAAGGG + Intronic
1121593336 14:95137401-95137423 AAGGGAAAGAAAAAGGGGAAGGG + Intronic
1121593377 14:95137531-95137553 AAGGGAAAGAAAAAGGGGAAGGG + Intronic
1121764067 14:96470247-96470269 AAGGCGGAGAAGGATGAGGAGGG + Intronic
1122322286 14:100862253-100862275 AAGGAGAAGAAAAAGAGAGAGGG - Intergenic
1122570170 14:102692748-102692770 AAGAAAAAGAAAAAGAAGGAAGG - Intronic
1123016615 14:105378765-105378787 TGTACGAAGAAAAAGGAGGAAGG - Intronic
1124189938 15:27565784-27565806 AAGGGGAGGAAAAAGAGGGAAGG + Intergenic
1124371609 15:29107505-29107527 ATGCCGAACAAAGAGGAGGAAGG - Intronic
1124534071 15:30529389-30529411 AAGGCTAAAAAGAAGGAAGAGGG - Intergenic
1124764576 15:32478221-32478243 AAGGCTAAAAAGAAGGAAGAGGG + Intergenic
1124875859 15:33592613-33592635 AAGGAGAAGAAAATGGAGTCTGG + Intronic
1125057654 15:35381419-35381441 AAGAAAAAGAAAAAAGAGGAAGG + Intronic
1125119810 15:36141853-36141875 AGGAGGAAGAAAGAGGAGGAAGG + Intergenic
1125254819 15:37751411-37751433 AAGAGGAAGGAAAAAGAGGAAGG + Intergenic
1125320893 15:38487014-38487036 AAAGAGAAGAAAAAAGGGGAAGG - Exonic
1125891958 15:43273705-43273727 AAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1126390459 15:48144169-48144191 GAGGAGAAAAAAAAGGAGAAAGG + Intronic
1126404874 15:48313595-48313617 AAGTCGCAGAAATAGGTGGATGG - Intergenic
1126407448 15:48335666-48335688 AAGGGGAAGAAAGAGAAGTATGG - Intronic
1126629966 15:50724273-50724295 AAGACTAAGAAAAATGAAGAAGG + Intronic
1126842356 15:52729603-52729625 AAGGGGTAGAAAGAGGAGAATGG + Intergenic
1127022238 15:54760734-54760756 AAGGGGAGGAAAGAGTAGGAAGG + Intergenic
1127071860 15:55295201-55295223 AAGGAGAAGGAAAGGGAGGGAGG + Intronic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1127296232 15:57610972-57610994 AAGACCAAGAAGAAGGTGGACGG + Intronic
1127315273 15:57788954-57788976 AAGGGGAAGAAAGAGAAAGAGGG - Intergenic
1127446391 15:59067343-59067365 AAGGGGAAGGGAAAGGAGAAAGG - Intronic
1127517808 15:59713373-59713395 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1127591098 15:60424384-60424406 AAGGGGAAGAAAAAACTGGAAGG + Intronic
1127822659 15:62673399-62673421 GAGGCGAAAAACAAGGAGAAGGG - Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128095843 15:64954846-64954868 AAGGAGAAGAAAGAAGAAGAAGG - Intronic
1128175055 15:65547964-65547986 AAGGTGAATACAAAGTAGGAAGG + Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128586653 15:68858155-68858177 AAGGAGAGGAAAAAGAAAGATGG - Intronic
1128909168 15:71496554-71496576 AAGGTAAAGAAAGAGGAGAAAGG + Intronic
1129044877 15:72725761-72725783 AAGGGGAAGAGGAAGGGGGAAGG - Intronic
1129044968 15:72725948-72725970 AGGGGGAAGGGAAAGGAGGAAGG - Intronic
1129077948 15:73013707-73013729 TAGGCAAGGAAAAAGCAGGAAGG + Intergenic
1129240978 15:74252121-74252143 AAGGCAAAGAATGAGGTGGAGGG - Intronic
1129350005 15:74950469-74950491 AAGGCAAAGGAAAGGAAGGAAGG - Intergenic
1129553470 15:76479161-76479183 ATGAGGAAAAAAAAGGAGGAGGG + Intronic
1129560975 15:76568258-76568280 AAGACGGAGAAAAAGAAGAATGG - Intronic
1129765040 15:78159297-78159319 TGGGGGAAGAAAAAGGAGGAGGG - Intronic
1129785903 15:78309895-78309917 ATGACGAAGGAAAAGGAGGTGGG + Intergenic
1129876961 15:78981952-78981974 ATGGAGAAGAAAAGGAAGGAGGG - Intronic
1129917795 15:79289669-79289691 AAGGAGAAGGAAAAGAAGGTGGG - Intergenic
1130112725 15:80979283-80979305 AAGGGCAAAAAAAAGAAGGAAGG - Exonic
1130130404 15:81136359-81136381 AAGGGGAAGGGAAAGGAAGAAGG + Intronic
1130886460 15:88096548-88096570 TAGGCAAAGAAAAAGGATGCAGG - Intronic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131014142 15:89043472-89043494 AAGGAGAGGAAGAAGGGGGAGGG + Intergenic
1131284840 15:91048191-91048213 AAGAAGAAGAAGAAGAAGGAGGG - Intergenic
1131319790 15:91376351-91376373 AATGTGAAGAAGTAGGAGGAAGG + Intergenic
1131430162 15:92380888-92380910 AAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1131465888 15:92654812-92654834 AAGAAGAAGAAAAAGTAGGCGGG + Intronic
1131683143 15:94744895-94744917 AAGGAGAAGGGAAAGGAGGGAGG + Intergenic
1131744725 15:95434853-95434875 AGGAAGAAGAAAAAGAAGGAAGG - Intergenic
1131791459 15:95970209-95970231 AAAGGGAAGGAAAGGGAGGAGGG + Intergenic
1131872162 15:96774449-96774471 AAAGCCAAGAAACAGGAAGATGG + Intergenic
1132100197 15:99017557-99017579 AAGGCCAAGGTAAAGGATGAGGG - Intergenic
1132185338 15:99798349-99798371 AAGGGGAGGAAGAAGGAGGGAGG + Intergenic
1132431651 15:101766182-101766204 AAGGAGAGGAAGAAGGAGGGAGG - Intergenic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133314018 16:4870903-4870925 AAGATGAAGAAAAAGGGGGCAGG + Exonic
1133371335 16:5247992-5248014 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1133392789 16:5422898-5422920 GAGGGGAGGAAAGAGGAGGAGGG + Intergenic
1133901395 16:9978554-9978576 AAGGAGGAGTAAGAGGAGGATGG - Intronic
1134019480 16:10911526-10911548 AAGGAAAGGAAAAAGAAGGAAGG - Intronic
1134287185 16:12872041-12872063 AAGAGGAAGAAGAAGGAGGAGGG - Intergenic
1134291726 16:12907069-12907091 AAGGAAAAAACAAAGGAGGAAGG - Intronic
1134449297 16:14353960-14353982 GAGGCAAAGAAAGGGGAGGAGGG + Intergenic
1134449341 16:14354068-14354090 AAGGGGAAGAAATGGGAGGAGGG + Intergenic
1134610268 16:15602637-15602659 GAGGAGAAAGAAAAGGAGGAGGG + Intronic
1134631236 16:15757580-15757602 AAAAGGAAGAAAAAAGAGGATGG + Intronic
1134649573 16:15898111-15898133 AAGAAGATGAAAGAGGAGGAGGG - Intergenic
1134649599 16:15898200-15898222 AGGGAGAAGAAAGAGGAGGAGGG - Intergenic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1135077714 16:19408692-19408714 ATGGCTTAGAGAAAGGAGGAGGG - Intergenic
1135170434 16:20178908-20178930 AAAGACAAGAAGAAGGAGGAGGG - Intergenic
1135913147 16:26579214-26579236 AAGGAGGAGAAGAAGAAGGAAGG - Intergenic
1136094771 16:27947335-27947357 AAGGAGAAGAAAGAAGAAGAAGG + Intronic
1136452170 16:30359609-30359631 AAGAGCAAGAACAAGGAGGAGGG + Intronic
1136539095 16:30918701-30918723 AAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1136768894 16:32815788-32815810 AAAGAAAAGAAAAAGGAGAAAGG + Intergenic
1137219770 16:46437160-46437182 AAGGAAAAGGAAAAGAAGGAAGG - Intergenic
1137386497 16:48047474-48047496 AAGGAGGAGAAGCAGGAGGAGGG + Intergenic
1137386510 16:48047531-48047553 AAGGGAAAGGAACAGGAGGAAGG + Intergenic
1137758794 16:50923963-50923985 AAGGAGAAAAAGAGGGAGGATGG + Intergenic
1137811673 16:51358622-51358644 AGGGCCAAGAAAGAGGATGAAGG + Intergenic
1137863686 16:51871795-51871817 AAGGAGAAGAGAAGGAAGGAGGG + Intergenic
1138075769 16:54041238-54041260 AAGGCGAAGGGAAAGCAAGACGG + Intronic
1138289596 16:55835595-55835617 AAGGAGAAGAAGGAGAAGGAGGG + Intergenic
1138339063 16:56276737-56276759 AAGGCTAAATAAAAGGAGGGAGG + Intronic
1138621174 16:58212568-58212590 AAAGGAAAGAATAAGGAGGAAGG + Intergenic
1138901964 16:61283090-61283112 AAAACAAAGAAAAAGGAGGAGGG - Intergenic
1139018128 16:62714847-62714869 AAGGAGAAAAAGAAGGAGAAGGG - Intergenic
1139082743 16:63544205-63544227 AGGACAAAGAAAAAGAAGGAGGG + Intergenic
1139144499 16:64307625-64307647 AGAGAGAAGGAAAAGGAGGAAGG + Intergenic
1139322653 16:66127888-66127910 AAGCGGAAGAAAAGGGAAGATGG + Intergenic
1139605162 16:68013062-68013084 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1139800936 16:69522161-69522183 TAGGTGAAGAAGAGGGAGGAGGG + Intergenic
1139897739 16:70301111-70301133 AAAGACAAGAGAAAGGAGGAAGG - Intronic
1140269918 16:73456360-73456382 CAGAAGAAGATAAAGGAGGAAGG - Intergenic
1140351743 16:74268699-74268721 AAGGTGTAGAAAAAGCAGCACGG + Intergenic
1140657040 16:77151687-77151709 AAGGAGAGGAAAAATGAGAATGG - Intergenic
1140683040 16:77404044-77404066 AAGCAGAGGAAAAGGGAGGAAGG - Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141190897 16:81823939-81823961 AAGGGAAAGGGAAAGGAGGAAGG - Intronic
1141296695 16:82776267-82776289 AGAGGGAAGAAAAAGAAGGAAGG + Intronic
1141485215 16:84334255-84334277 AAGGGGAGGAAAGAGCAGGAAGG + Intergenic
1141890307 16:86922091-86922113 AAGGGGAAGGAAAGGGAAGATGG + Intergenic
1141950814 16:87338405-87338427 AAGGAGCAGAGAAGGGAGGATGG - Intronic
1142155814 16:88532463-88532485 AAGGCGGAGGAGGAGGAGGAGGG + Intronic
1142251482 16:88993875-88993897 AAGGAGAAAAAAAGGGAGGGAGG - Intergenic
1203071311 16_KI270728v1_random:1077899-1077921 AAAGAAAAGAAAAAGGAGAAAGG + Intergenic
1142475019 17:183533-183555 AAGGAGGAGGAAGAGGAGGACGG + Intergenic
1143048262 17:4100453-4100475 AAGGAGGGGAAAAAGCAGGAAGG + Intronic
1143270030 17:5668597-5668619 GAGGAGAAGTAAGAGGAGGAGGG - Intergenic
1143270041 17:5668653-5668675 GAAGAGAAGAAAGAGGAGGAAGG - Intergenic
1143287325 17:5800063-5800085 AAGGTGGAGGAGAAGGAGGAAGG - Intronic
1143391459 17:6561410-6561432 AAGGAGGAGGAAGAGGAGGAGGG - Intergenic
1143410849 17:6707504-6707526 AAGGAGGAGAAGGAGGAGGAGGG + Intronic
1143473905 17:7192356-7192378 AAAGCCAAGAAAAAGGAGAAAGG + Intronic
1143862662 17:9902130-9902152 AAGGAGGAGGAAAGGGAGGAGGG - Intronic
1143964197 17:10744952-10744974 AAGGCGAGGAAAAGGGTGGGAGG + Intergenic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1144225547 17:13141538-13141560 AAGGAGAAAAATTAGGAGGAAGG - Intergenic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144244743 17:13351947-13351969 AAGGAGAAGTAAAAGGAAAAGGG - Intergenic
1144664475 17:17092548-17092570 AAGGAGAAAGAAAAGGATGAGGG - Intronic
1144741624 17:17586176-17586198 AAGAAAAAGAAAAAGAAGGAAGG + Intronic
1144838506 17:18171260-18171282 AAGGAGAAGCAAAAGCCGGAGGG - Intronic
1144964782 17:19070124-19070146 AAATAGAAGGAAAAGGAGGAGGG - Intergenic
1144967346 17:19086028-19086050 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1144980573 17:19166038-19166060 AAGGAGAAGGATGAGGAGGAGGG - Intergenic
1144983185 17:19182054-19182076 AAATAGAAGGAAAAGGAGGAGGG + Intergenic
1144985040 17:19196185-19196207 AAATAGAAGGAAAAGGAGGAGGG - Intergenic
1144987649 17:19212195-19212217 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1145102975 17:20092066-20092088 AAGTAGAAGAGAAAGGAGGGAGG - Intronic
1145221623 17:21094198-21094220 GAGGGGGAGAAAGAGGAGGAGGG + Intergenic
1145296406 17:21596046-21596068 AAGGGAAAGAAAAAGGAAAATGG + Intergenic
1146087208 17:29840588-29840610 ATGGTGAAGAAAATGGAAGATGG + Intronic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146978261 17:37135015-37135037 GAGGGGGAGAGAAAGGAGGAAGG + Intronic
1147498720 17:40942204-40942226 AAGGAGAAGAAGGAGAAGGAGGG - Intergenic
1147556623 17:41483558-41483580 GATGGGCAGAAAAAGGAGGAAGG - Intergenic
1147800202 17:43079962-43079984 AAGGAGAAAAAAAAGCAGAAAGG - Intronic
1147881567 17:43657561-43657583 AAGGAGATGGCAAAGGAGGAAGG + Intronic
1148112540 17:45154128-45154150 AAAGTGAAGAAATAGGAGGCCGG - Intergenic
1148413552 17:47488360-47488382 AAAAAGAAGAAAAAGTAGGAGGG + Intergenic
1148467564 17:47874023-47874045 AAGAGGAAGAGGAAGGAGGAGGG - Intergenic
1148467576 17:47874075-47874097 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
1148566897 17:48638626-48638648 AGGACGAAGAGAAAAGAGGAGGG + Intergenic
1148767155 17:50046118-50046140 AAGGGGAAGAGAAAGGGGAAGGG + Intergenic
1149008587 17:51831608-51831630 AAGGAAAACAAAAAAGAGGAAGG + Intronic
1149107109 17:52982657-52982679 AAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1149114165 17:53071729-53071751 GAGAAGAAGAAAAAGGAGGGAGG + Intergenic
1149195154 17:54110747-54110769 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1149278318 17:55071091-55071113 AGGGAGAAGAAAAAGGAGATGGG - Intronic
1149540891 17:57467361-57467383 AAAGGGAAGAGAAAAGAGGAAGG + Intronic
1149665784 17:58363998-58364020 AAGGAGAAGAGAGAGGAAGAAGG + Intronic
1149749366 17:59130062-59130084 AAAGGGAAGAAAAAAGAGAAAGG + Intronic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1150146431 17:62773488-62773510 AAGGGGAAGAAATAAGTGGAGGG + Intronic
1150278042 17:63912149-63912171 GAGGAGGAGAAAAAAGAGGACGG - Intronic
1150279357 17:63920034-63920056 GAGGAGGAGAAAAAAGAGGAGGG - Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150466829 17:65400698-65400720 AAGGAGAAACAAAAGAAGGAAGG - Intergenic
1150628600 17:66859822-66859844 AAGGGGGAGGAGAAGGAGGAGGG - Intronic
1150789657 17:68193118-68193140 AAGGGTAGGGAAAAGGAGGATGG - Intergenic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151158736 17:72146754-72146776 AAGGAGGAGGAAGAGGAGGAGGG + Intergenic
1151231085 17:72685610-72685632 AAGCCAAAGAAAAAGTATGAGGG - Intronic
1152000090 17:77639931-77639953 AAGAGGAAGAAGGAGGAGGAGGG - Intergenic
1152105187 17:78324594-78324616 AAGGGGAAAAAAAGGGAGGGAGG - Intergenic
1152256868 17:79244988-79245010 AAAGAAAAGAAAAGGGAGGAAGG - Intronic
1152328569 17:79657134-79657156 GAGGAGAAGAATGAGGAGGAAGG + Intergenic
1152731675 17:81975113-81975135 AAGGAGAAGAAAGAAGAAGAGGG - Intergenic
1153331306 18:3878460-3878482 GAGGAGGAGGAAAAGGAGGAAGG - Intronic
1153488363 18:5624942-5624964 AAGGTGAAGAAAGGGGAGGAAGG + Intronic
1153499737 18:5736329-5736351 AAAGCAAAGAAAAATGAAGACGG - Intergenic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1154095775 18:11413744-11413766 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1155064725 18:22258397-22258419 GAGGAGGAGGAAAAGGAGGAAGG - Intergenic
1155865227 18:30956546-30956568 AAGAGAAAGAAAAAGAAGGAAGG + Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156036706 18:32772465-32772487 AGGGAGAAGAACAAGAAGGAAGG - Intronic
1156055653 18:32999259-32999281 AAGGGGAGGAAAGAGGGGGAAGG + Intronic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156155906 18:34301378-34301400 AAGGGGAGGGAAAAGCAGGAAGG + Intergenic
1156190608 18:34715941-34715963 AGGGGAAAGCAAAAGGAGGAAGG + Intronic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156281966 18:35648033-35648055 AAGAAGAAGAAGAAGAAGGAAGG + Intronic
1156312459 18:35937303-35937325 AGAGAGATGAAAAAGGAGGAGGG + Intergenic
1156438808 18:37163359-37163381 AGGAGGAACAAAAAGGAGGAAGG - Intronic
1156472287 18:37384792-37384814 AAGGAGCAGATAAAGCAGGAGGG - Intronic
1156592083 18:38501821-38501843 AAGGAAGTGAAAAAGGAGGAAGG + Intergenic
1156724485 18:40111696-40111718 AAAGATAGGAAAAAGGAGGAGGG - Intergenic
1156753741 18:40494699-40494721 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156883513 18:42108115-42108137 AAGGAAGAGAACAAGGAGGAGGG + Intergenic
1157030493 18:43900972-43900994 AAGGCTAAGGAAGAGGAGGAAGG - Intergenic
1157237607 18:45979194-45979216 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
1157369634 18:47098995-47099017 AAGGAGAAGAAAGAGAAGGAAGG - Intronic
1157632913 18:49117804-49117826 AAGACGAAGACAAAGGAGCCAGG - Intronic
1157763301 18:50280702-50280724 AAGGAGAAGAAAAATAAGGGGGG - Intronic
1158085312 18:53643950-53643972 AAAGGGAAGCAAAAGGAGTAAGG - Intergenic
1158197057 18:54899642-54899664 AAGAGGAAGAAGAAGAAGGAAGG - Intergenic
1158217348 18:55113876-55113898 AAGGCTCAGAGAAAGGAGGCGGG - Intergenic
1158275297 18:55760519-55760541 AATGGAAAGAAGAAGGAGGAGGG - Intergenic
1158281944 18:55838124-55838146 AGGGGGAAGAAACAAGAGGAAGG + Intergenic
1158310108 18:56149023-56149045 AAGAGGAAGAAGAAGGAAGAGGG + Intergenic
1158516914 18:58138370-58138392 GAGGGGAGGAAAGAGGAGGAGGG - Intronic
1158623313 18:59050800-59050822 AAGGGGAAGAATCAGGAGTAAGG - Intergenic
1158672154 18:59486076-59486098 AAGGCCAAGATTAAGGAGCAAGG - Intronic
1158794423 18:60826008-60826030 AAGGAGAATAACAAGGTGGAAGG + Intergenic
1159015841 18:63101223-63101245 ATGGCCAAGAAAAAGAAGGCAGG + Intergenic
1159150632 18:64518742-64518764 AAGGAGAAGGAAAGGAAGGAGGG - Intergenic
1159271240 18:66153814-66153836 AAGACGAAGAAGGAGGAGGAGGG + Intergenic
1159896438 18:74001363-74001385 AAGGGGAGGAAAAAGTAGGAAGG - Intergenic
1159933089 18:74334324-74334346 AAGGGGAGAAAAGAGGAGGAGGG + Intronic
1160228854 18:77031458-77031480 AAAGCTAAGAAAAAGGAGGCAGG + Intronic
1160820986 19:1057940-1057962 ACGGAGAAGAAGAAGGAGGCTGG - Exonic
1160971250 19:1768745-1768767 GAGGTGAAGAAAACAGAGGAAGG + Intronic
1161277715 19:3428188-3428210 AAAGAAAAGAAAAAGAAGGAAGG + Intronic
1161370603 19:3908843-3908865 AAGGAGGAGAAGGAGGAGGAAGG - Intronic
1161647589 19:5463381-5463403 AAGGAGAAGGAAAAGAAGAAAGG - Intergenic
1161918740 19:7250353-7250375 AAGGGAAAGAGGAAGGAGGAGGG + Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162197487 19:8996729-8996751 AATGAGGAGAAAGAGGAGGAAGG + Intergenic
1162444817 19:10716346-10716368 AAGATGGAGAAAGAGGAGGAGGG - Intergenic
1162991587 19:14306349-14306371 AAGGAAAGGAAAAAGGAGAAAGG - Intergenic
1163113042 19:15173001-15173023 AAGAGGAAGAAGAAGGAAGAGGG - Intronic
1163113059 19:15173045-15173067 AAGAAGAAGAAGAGGGAGGAGGG - Intronic
1163171172 19:15532259-15532281 AAGAAGAAGAGAAGGGAGGAGGG - Intronic
1163351361 19:16777968-16777990 AAAGGGAAGGAAATGGAGGAAGG + Intronic
1163760805 19:19135436-19135458 AAAGGGAAGAAGAGGGAGGAGGG - Intronic
1163879631 19:19906164-19906186 AAGGTGCAGAGAAAGGAGAAAGG - Intronic
1164426027 19:28142621-28142643 AAGAGGAGGAAAAAAGAGGAAGG + Intergenic
1164439978 19:28269287-28269309 AAAGAGAAGAGAAAGAAGGAAGG - Intergenic
1164544855 19:29151867-29151889 AAGGGAAAGGGAAAGGAGGAAGG + Intergenic
1164559148 19:29276650-29276672 AAAGGAAAGAAAAAGGAGAAAGG - Intergenic
1164783236 19:30910160-30910182 AAGGCAAGGAATAAGAAGGATGG + Intergenic
1164847289 19:31444228-31444250 AAGAAGAAGAAGAAGGTGGAAGG + Intergenic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165686311 19:37823877-37823899 TAAGGGAAGAAAAAGGAAGATGG + Intergenic
1165757933 19:38304902-38304924 AAAGTGAAGAAGAAGGAGAAGGG + Exonic
1165910286 19:39221805-39221827 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1165914771 19:39251319-39251341 AGGGCTAGGAAAAAGGAGGCTGG - Intergenic
1165998855 19:39865432-39865454 AAGGAGGGGAAAAGGGAGGATGG + Intronic
1166353296 19:42211390-42211412 AGGGAGAAGAAAAGGAAGGAAGG + Intronic
1166408269 19:42539393-42539415 AAGGGGAAGGAAGAGCAGGAAGG - Intronic
1166548578 19:43649659-43649681 AAGGAGAAGGGAAAGAAGGAAGG + Intronic
1166553435 19:43682478-43682500 AAAGAAAAGAAAAAGGAGAAGGG + Intergenic
1166692761 19:44833578-44833600 AAGGAGGAAGAAAAGGAGGAAGG + Intergenic
1167130493 19:47582177-47582199 AAGGAGGAGGAAGAGGAGGAGGG - Intergenic
1167181100 19:47904000-47904022 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167181768 19:47909359-47909381 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167182418 19:47914749-47914771 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167183085 19:47920101-47920123 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167183753 19:47925451-47925473 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167184383 19:47930501-47930523 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167185055 19:47935852-47935874 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167185707 19:47941241-47941263 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167186374 19:47946599-47946621 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167187025 19:47951987-47952009 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167187675 19:47957370-47957392 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167191268 19:47991670-47991692 AAAGAGAAGGAAGAGGAGGAGGG - Intronic
1167214236 19:48153871-48153893 AAGAGGAAGAAGGAGGAGGAAGG - Exonic
1167258653 19:48445069-48445091 AAGACCAAGAAAGAGGAGGTGGG + Intergenic
1167346911 19:48951984-48952006 AAAGCCAAGATAAAGGGGGAGGG - Intergenic
1167494021 19:49807569-49807591 AAGGCTGAGAAAGAGGAAGAGGG - Intronic
1167542166 19:50096262-50096284 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167542601 19:50099327-50099349 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167543038 19:50102392-50102414 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167543474 19:50105455-50105477 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167544147 19:50110799-50110821 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167544822 19:50116152-50116174 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167545497 19:50121504-50121526 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167546174 19:50126832-50126854 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167546851 19:50132167-50132189 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167547509 19:50137540-50137562 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167579069 19:50331484-50331506 AAGGGGAAGAAGAAGGGGGAGGG - Intronic
1167637591 19:50664099-50664121 AAAGAAAAGAAAAAGGAGGCTGG - Intronic
1167709396 19:51100609-51100631 AAAGAAAAGAAAATGGAGGAAGG + Intronic
1167845913 19:52164018-52164040 AAGGAAAAGAAAAAGAAGGAAGG + Intronic
1167867799 19:52342462-52342484 AAAGCCAAGAAAAAAGAAGAGGG - Intronic
1168205441 19:54847241-54847263 AAGGAGAAAGAAGAGGAGGATGG - Intronic
1168251571 19:55145308-55145330 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1168251785 19:55146112-55146134 GAGGCGAAGATAAGGGGGGATGG + Intronic
1168288109 19:55344452-55344474 AAGGCTACCAGAAAGGAGGAAGG + Intronic
1168543476 19:57231545-57231567 AAGGGGAAGAAGAAAGAGTAAGG - Intronic
925317017 2:2934286-2934308 AAAGGGAAGAAAGGGGAGGAAGG - Intergenic
925372940 2:3360932-3360954 AAGGGGAGGAGAAGGGAGGAGGG + Intronic
925378645 2:3407810-3407832 AAGAAAAAGAAAATGGAGGAGGG + Intronic
925402563 2:3586022-3586044 GAGGAGAGGAAAAAGGAGGAGGG + Intergenic
925562821 2:5216544-5216566 GAGGAGGAGAAAAAGGAAGAGGG - Intergenic
925606953 2:5669342-5669364 AGGGCGGGGAAAAGGGAGGAAGG + Intergenic
925697751 2:6599137-6599159 AAGAAGAAGAAAAAGAAAGAAGG + Intergenic
925704699 2:6673367-6673389 AAGCAGAAGGAAAAGGAGAAGGG + Intergenic
925730011 2:6912975-6912997 AGCGCGAACAAACAGGAGGAAGG - Intergenic
925849544 2:8067516-8067538 AAGAAGGAAAAAAAGGAGGAGGG + Intergenic
925853346 2:8105650-8105672 AAAGAGAGGGAAAAGGAGGAAGG - Intergenic
925930986 2:8707760-8707782 AAGGAGATGAAAAAGAATGAGGG - Intergenic
925984389 2:9204307-9204329 AAGGCGAAGAAAAAGGAGGAAGG - Intergenic
926097411 2:10091208-10091230 AAGCAGAAGAAAAATGAGAAGGG + Intergenic
926209311 2:10857525-10857547 GAGACGAAGGAAGAGGAGGAGGG - Intergenic
926211803 2:10876686-10876708 AAGAGAGAGAAAAAGGAGGAAGG - Intergenic
926233018 2:11019106-11019128 AGGAAGAAGAAAAAGGAGGTGGG - Intergenic
926317524 2:11722034-11722056 AAGGCAGAGAAAAAGAAGGAGGG + Intronic
926421017 2:12699410-12699432 AAGGGGGAGAAAAAGGAGAAGGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926574462 2:14564708-14564730 AAGAAGAAGAAACAGGAGGGAGG + Intergenic
926725482 2:15994233-15994255 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
926828785 2:16937170-16937192 AAGAAGAAGAAAAAGAAGGAAGG + Intergenic
926881080 2:17543819-17543841 AAGGAGAAAAAACAGGAGGAAGG - Intronic
926887212 2:17609254-17609276 AAGGAGAAGACAGAGGAGTAGGG + Intronic
927056793 2:19372992-19373014 AAGGGGAAGAAGAAGGTGGTTGG - Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927396039 2:22652436-22652458 AAAGCAAAGAAAAATGAAGAAGG + Intergenic
927648586 2:24897234-24897256 GAGGAGGAGAAAAAGGAGAAGGG - Intronic
927724341 2:25409750-25409772 AAAAAGAAGAAAAAGGAGGCAGG - Intronic
927793013 2:26025514-26025536 AAGGGGAAGAAAAAGAGAGAGGG + Intergenic
927946669 2:27138856-27138878 GAGGAGAGGAATAAGGAGGAAGG + Intronic
928054444 2:28037962-28037984 AAGGGGAAGAGAAAGGGAGAAGG + Intronic
928111744 2:28516261-28516283 AAGGGGAAGAAAAGGCAGGTAGG - Intronic
928309443 2:30197341-30197363 AAAGAAAAGAAAATGGAGGAAGG + Intergenic
928317021 2:30254626-30254648 CAGGCCCAGCAAAAGGAGGAGGG - Intronic
928335249 2:30392447-30392469 AAGGAAAATAAAAAGGAAGAGGG + Intergenic
928373777 2:30759162-30759184 AAGGAGGAGAAAAACGAGGGAGG - Intronic
928533794 2:32219399-32219421 AGGGGGCAGAAGAAGGAGGAGGG - Intronic
928660804 2:33500186-33500208 AAAGAGAGGAAAAAGGAGGGAGG + Intronic
929015018 2:37485283-37485305 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
929341552 2:40825008-40825030 AAGGAAAAGAAACAGGAGGATGG + Intergenic
929524967 2:42693461-42693483 AAGGGGAAGGAAAAGCAGGAAGG - Intronic
929593196 2:43160067-43160089 AGGGAGGAGAAAAAGGAGGAGGG - Intergenic
929608208 2:43249843-43249865 AAACCGAAGAAAAAAGAGTATGG - Intronic
929766445 2:44847876-44847898 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
929875140 2:45790674-45790696 AAGGAGAAGAAAAACGTGAAGGG - Intronic
929879639 2:45824605-45824627 AAGGAGGAGAAAAAGAAGGGAGG - Intronic
930030629 2:47056221-47056243 AATGCCCAGAAAAAGAAGGAAGG - Intronic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
930556787 2:52906260-52906282 AAGGGGAAGTAGAAGGAGGCTGG - Intergenic
930581855 2:53221074-53221096 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930778322 2:55197120-55197142 AAGGAGAGGAAAAAATAGGAAGG + Intronic
930989717 2:57638315-57638337 AAGATGAAGGAAAAGGAGGTAGG + Intergenic
931129519 2:59318465-59318487 AACAAGAAGAATAAGGAGGAGGG + Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931364946 2:61611270-61611292 AAGGGTAAGAGAAAGGAAGAAGG + Intergenic
931649618 2:64455448-64455470 AAAGCAATGAGAAAGGAGGAAGG - Intronic
931796152 2:65712148-65712170 AAGGGGAAGGGAAAGAAGGAAGG - Intergenic
931975414 2:67638654-67638676 AAAGCTAAAAACAAGGAGGAAGG - Intergenic
931992793 2:67807873-67807895 AAGGGGAAGAAGAAGAAGAAGGG - Intergenic
932099416 2:68883907-68883929 AAGGAGAAAGAAAAGGAGAAAGG - Intergenic
932450886 2:71810169-71810191 AAGGGAAAGAAAGAGGAGGAGGG + Intergenic
932734405 2:74244495-74244517 AAGGGGAAAGAAAAGAAGGAAGG - Intronic
932741779 2:74296339-74296361 AGGAGGAAGAAAAAGGAGAAAGG - Intronic
932822585 2:74914220-74914242 AAAAGGAAAAAAAAGGAGGAAGG + Intergenic
933096739 2:78192904-78192926 AAGGAGAAGAAAAAGAAAAAGGG + Intergenic
933333880 2:80929410-80929432 AAGCTAAAGAAAAAGAAGGATGG + Intergenic
933366017 2:81355069-81355091 AAGGCAAATAAGAAGGAGGGAGG + Intergenic
933387907 2:81634652-81634674 AAGGAGAAGGAAAAGTGGGAAGG + Intergenic
933481374 2:82861217-82861239 GAGGAGGAGAAAAAGAAGGAAGG - Intergenic
933569725 2:83995427-83995449 AAGGAAAGGAAAAAGGAAGAAGG - Intergenic
933895373 2:86806437-86806459 CAGGCCAAGGACAAGGAGGAAGG - Intronic
934141712 2:89053430-89053452 GATGCGTAGGAAAAGGAGGAGGG - Intergenic
934227531 2:90147116-90147138 GATGCGTAGGAAAAGGAGGAGGG + Intergenic
934873072 2:97885873-97885895 AAGGAGAAGAGAAAGGAGAAAGG - Intronic
934903250 2:98177559-98177581 AAGGAGAAAAAAAAAAAGGAGGG - Intronic
935489523 2:103699017-103699039 AAGGATAAGAAAAATGGGGAAGG - Intergenic
935809169 2:106779908-106779930 AAGGAGAAGAAAAAGAATGCTGG + Intergenic
936122497 2:109758941-109758963 GAGGGGAAGAAAAAAGAGGAGGG + Intergenic
936222196 2:110612531-110612553 GAGGGGAAGAAAAAAGAGGAGGG - Intergenic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936548565 2:113414292-113414314 ATAGGGAAGAAAAATGAGGAAGG - Intergenic
936977236 2:118232376-118232398 AAGGAGAAGAGGAAGGAAGAGGG - Intergenic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937217396 2:120321358-120321380 AACTCGAAGAAGAAGGAGGAGGG - Intergenic
937284478 2:120741528-120741550 AAGGCGGAGGAAACGGAGGAGGG - Intronic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937483099 2:122283199-122283221 AGGAAGAAGAAAAAGGGGGAGGG - Intergenic
937520109 2:122703381-122703403 AAGGAGAAGAAAAAGAGGGGAGG + Intergenic
937992357 2:127671733-127671755 AAGTAGAAGAAAAAGGAAGGAGG + Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938239632 2:129733330-129733352 AAGGAGCACAAACAGGAGGAGGG - Intergenic
938985915 2:136576066-136576088 AAGGCAAAGAAGAAAGAGAAGGG + Intergenic
939069454 2:137521492-137521514 AATGAGAAGAAAAAGAGGGATGG - Intronic
939280071 2:140052541-140052563 GAGAAGAAGAAAGAGGAGGAAGG + Intergenic
939596907 2:144136442-144136464 AAGGAAAGGAGAAAGGAGGAAGG + Intronic
939614176 2:144344303-144344325 AAGGTGACTATAAAGGAGGAAGG - Intergenic
939987517 2:148845208-148845230 AAAAAGAAAAAAAAGGAGGAGGG - Intergenic
940179731 2:150918634-150918656 AAGGAAAAGAAAAGAGAGGAGGG + Intergenic
940315115 2:152320246-152320268 AAGGAGAAGGAAAAGTGGGAAGG - Intergenic
940527506 2:154835683-154835705 AAGGGAGAGAGAAAGGAGGAAGG - Intronic
940609837 2:155976295-155976317 AAGGCCAAAAATAAGGAGAAGGG + Intergenic
940924990 2:159354812-159354834 AAGCAGAAGAAAGAAGAGGAAGG + Intronic
941067387 2:160919005-160919027 AAGTCAAACAAAAAGGAGGATGG + Intergenic
941198589 2:162480847-162480869 AAGAGGTGGAAAAAGGAGGATGG + Intronic
941315450 2:163986400-163986422 AAAGGGAAGGATAAGGAGGAAGG + Intergenic
941958105 2:171225447-171225469 AAGGGGAAAAAAAAGGAAAAAGG + Intronic
941999703 2:171633741-171633763 AAGGCAAAGAAAAGGAAGGAAGG - Intergenic
942103332 2:172607762-172607784 CAGGGGAAGGAAAAGGAGCAGGG + Intronic
942310738 2:174654575-174654597 AAGGCAAAGAGAAAGGGGGTTGG - Intronic
942502572 2:176607094-176607116 AAGGAGAAGGAAGAGGAGGTGGG + Intergenic
942570894 2:177313274-177313296 AAGAGAAAGAAAAGGGAGGAAGG - Intronic
942715265 2:178884569-178884591 AAGGAAAACAAAAAGGAGGGAGG - Intronic
943330749 2:186556248-186556270 AAGGAGAAAAGAAAGAAGGAAGG - Intergenic
943662554 2:190574832-190574854 AAAGAAAAGAAAAAGAAGGAAGG - Intergenic
943913173 2:193593807-193593829 AAGAGGAAGAAAGAGCAGGAAGG + Intergenic
944019315 2:195082411-195082433 AAGAAGAAAAAAGAGGAGGAAGG - Intergenic
944046232 2:195414508-195414530 AAGGGGAGGAAAGAGTAGGAAGG + Intergenic
944123127 2:196262858-196262880 AACACAAAGATAAAGGAGGACGG - Intronic
944711462 2:202338506-202338528 AAAACAAAGAAAAAGGAGGGAGG - Intergenic
944755786 2:202760462-202760484 AAGGCGAAGACAAAGAGGGGAGG - Intronic
944996581 2:205301589-205301611 AAGGAGAAGAAAAAGGAAAAGGG + Exonic
945041277 2:205745670-205745692 AAGGGGAAGGAAAGGGAAGAAGG + Intronic
945042780 2:205755885-205755907 AGGGTGAAGAGAAAGGTGGATGG + Intronic
945053199 2:205845003-205845025 AAGCAGAAGAAAAAGAAAGAAGG + Intergenic
945298715 2:208195982-208196004 AATGCGAAGAGAAAGCAGCATGG - Intergenic
945474346 2:210263903-210263925 AAGGCTAAGAAAAAGCAGCTAGG - Intergenic
945879379 2:215310932-215310954 AAGCCTATTAAAAAGGAGGATGG + Intergenic
946051630 2:216867603-216867625 AAGGAGAAGGAAGAGGAAGAGGG - Intergenic
946410352 2:219512506-219512528 AAGGAGAAGAGAGAGAAGGATGG + Intergenic
946463663 2:219892192-219892214 AAGAGGAAGGAAAATGAGGAGGG + Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946655720 2:221944519-221944541 AAGGCAAAGAAAAAGGCTAAAGG + Intergenic
946756332 2:222951532-222951554 AAAGCAAAGAAAAAGCAGGAAGG - Intergenic
947103209 2:226643686-226643708 AAAGGGAAAAAAAAGGAGGGGGG + Intergenic
947135384 2:226972420-226972442 AGGGCTGAGAAAGAGGAGGATGG - Intronic
947251775 2:228114763-228114785 TAGGAGAAGAAAAATGAGAATGG - Intronic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947691866 2:232145721-232145743 AAAGCTAAGAAAACAGAGGATGG - Intronic
947909145 2:233790355-233790377 AAGAAGGAGAAAAAGGGGGAGGG - Intronic
948069716 2:235110642-235110664 AAAGAGAACAAAAAGGAGGAAGG + Intergenic
948091818 2:235301830-235301852 AGGATGAAGAGAAAGGAGGAGGG - Intergenic
948200262 2:236124461-236124483 GAGGCGAGGAACAAGGAGAAGGG + Exonic
948488304 2:238295259-238295281 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
948497618 2:238362552-238362574 AAGAGGGAGAAAAGGGAGGAAGG + Intronic
948538992 2:238672320-238672342 AAGGAGGAGAAGAAGGAGAAGGG - Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
948939188 2:241187715-241187737 GAGGGGGAGAAACAGGAGGAGGG + Intergenic
1168863580 20:1064278-1064300 AAGAGGAAGAAAAAGGAGGGAGG + Intergenic
1169118830 20:3083539-3083561 AGGGCGAGGAGGAAGGAGGAAGG - Intronic
1169686588 20:8280754-8280776 AAGGAAAATATAAAGGAGGATGG + Intronic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1169894789 20:10491414-10491436 ATGGAGAAGACAAAGGAGCAAGG - Intronic
1170020663 20:11833864-11833886 AAGAAGAAAAGAAAGGAGGAAGG + Intergenic
1170034311 20:11973852-11973874 AAGAGGAGGAAGAAGGAGGAAGG + Intergenic
1170236093 20:14106321-14106343 AAGGGGAAGGAAGAGAAGGAAGG + Intronic
1170311474 20:14997151-14997173 AAGGAGAAGGAAAAGGAGTGGGG + Intronic
1170333378 20:15240574-15240596 AAGAAGAAGAAAAAGGAAAATGG + Intronic
1170506784 20:17034835-17034857 AAGGCTTAGAAAAAGGAAGTGGG - Intergenic
1170519986 20:17175114-17175136 AAGGCAAGGAACATGGAGGATGG + Intergenic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170731634 20:18981047-18981069 AGAGGGAAGAAAAAGGAGGGAGG - Intergenic
1170821338 20:19758158-19758180 GAGGAGAGGAAAGAGGAGGAGGG - Intergenic
1170925743 20:20721790-20721812 AAGGCAAAGAAAAAGGACAAAGG + Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172635699 20:36408239-36408261 AAAGGGAAGAACAGGGAGGAGGG + Intronic
1172813607 20:37669442-37669464 AAGACAGGGAAAAAGGAGGAAGG - Intergenic
1172898321 20:38316191-38316213 GAGGGGAAGAGAAAGAAGGAAGG - Intronic
1172957649 20:38772526-38772548 AAGGGGAAAAAATAGGAGGAGGG - Intergenic
1173858323 20:46265775-46265797 AAGAAGAAGAAAAAGGAGAATGG - Intronic
1174004305 20:47398255-47398277 AAGGAGAAGGGAAAGGAAGAGGG + Intergenic
1174066660 20:47870736-47870758 AAGGCAAAGAGGAGGGAGGAAGG + Intergenic
1174166098 20:48584562-48584584 AAGGAGGAAAGAAAGGAGGAAGG - Intergenic
1174707006 20:52667458-52667480 ATGGCGGGGAAAAAGGAGAAAGG - Intergenic
1174709531 20:52690281-52690303 AAGGAGAAGAAAAAGGAGAAGGG - Intergenic
1174755127 20:53150716-53150738 GAGGAAAAGAAAAAGAAGGAGGG + Intronic
1174887192 20:54348820-54348842 AAGTTGAAGAAAAAGCAGGAAGG + Intergenic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175155294 20:56967287-56967309 ACGGAGAAGAAAGAGGAGGCTGG - Intergenic
1175531014 20:59674364-59674386 AAGGGGAAGGAACAGGAGAAGGG - Intronic
1175531033 20:59674430-59674452 AAGGGGAAGGAACAGGAGAAGGG - Intronic
1175565007 20:59967737-59967759 AAGGGGAAGGGAAGGGAGGAAGG - Intronic
1175587497 20:60154895-60154917 AAAGAGGAGAAAAAGGAAGAAGG - Intergenic
1175657774 20:60786927-60786949 AAGGGGAGGAGGAAGGAGGAGGG - Intergenic
1175665230 20:60852946-60852968 TAGGCCAAGAAGAGGGAGGAGGG + Intergenic
1176113980 20:63423094-63423116 GAGGCTAAGAAAACGGACGAGGG - Intronic
1176585823 21:8584404-8584426 AAAACAAAGAAAAAGAAGGAAGG + Intergenic
1177070640 21:16502339-16502361 AAGCTGAAGAAAAAGGGTGATGG - Intergenic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177212900 21:18091873-18091895 AAGGGGAAGGAAAAGTGGGAAGG + Intronic
1177506157 21:22020115-22020137 AAAGAGAAAAAAAAGAAGGAGGG + Intergenic
1177637480 21:23806409-23806431 AAGACAAAGAGAGAGGAGGAAGG + Intergenic
1178361025 21:31948598-31948620 AGGGAGGAGAAAAAGGAGGTGGG + Intronic
1178857221 21:36260225-36260247 AAGGGGAAGGGAAGGGAGGAAGG + Intronic
1178901852 21:36605075-36605097 AAGGCGAGGGACAAGGAGAAGGG - Intergenic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179250071 21:39664823-39664845 AAGGCGAGCAGCAAGGAGGAGGG - Exonic
1179941468 21:44641294-44641316 AAGGAGGAGGAAGAGGAGGAAGG + Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180268631 22:10561303-10561325 AAAACAAAGAAAAAGAAGGAAGG + Intergenic
1180760606 22:18199887-18199909 AAGGCAAAGAAAGAGCAGCAAGG + Intergenic
1180770920 22:18384184-18384206 AAGGCAAAGAAAGAGCAGCAAGG + Intergenic
1180775062 22:18424809-18424831 AAGGCAAAGAAAGAGCAGCAAGG - Intergenic
1180808137 22:18735864-18735886 AAGGCAAAGAAAGAGCAGCAAGG - Intergenic
1180828861 22:18887143-18887165 AAGGCAAAGAAAGAGCAGCAAGG + Intergenic
1180835013 22:18925475-18925497 GAGGCCATGAAAAAGGAGCAGGG + Intronic
1181054628 22:20254893-20254915 AAGGCCATGAAAGAGAAGGAAGG + Intronic
1181071061 22:20340829-20340851 AAGGCAAAGAAAGAGCAGCAAGG - Intergenic
1181161425 22:20962191-20962213 AAGAGAAAGAAAAGGGAGGAAGG - Intergenic
1181194132 22:21169778-21169800 AAGGCAAAGAAAGAGCAGCAAGG - Intergenic
1181215310 22:21323000-21323022 AAGGCAAAGAAAGAGCAGCAAGG + Intergenic
1181389803 22:22571959-22571981 AAGGGGAAGGGAAGGGAGGAAGG + Intergenic
1181525547 22:23483272-23483294 AAGGCAAAGAAAGAGCAGGAAGG + Intergenic
1181716985 22:24738158-24738180 AAGAAAAAGAAAAAGAAGGAAGG + Intronic
1181856993 22:25789038-25789060 AAAGAGAAGAAAAAGAAAGAAGG - Intronic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1181977211 22:26738473-26738495 AAGGAGGAGAACAAGGAGGAGGG - Intergenic
1182099525 22:27648162-27648184 AAGAAGGAGAAGAAGGAGGAGGG + Intergenic
1182185833 22:28401171-28401193 GAGGAGAAGGAAAAGGAGGGGGG + Intronic
1182466783 22:30521859-30521881 AAGGAAAAGAAAAAGAAGGAAGG - Intergenic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182773989 22:32817590-32817612 GACCAGAAGAAAAAGGAGGAAGG + Intronic
1182886407 22:33777666-33777688 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1182902087 22:33906994-33907016 AAGCAGAAGAAAAAGGAAAATGG + Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1182960592 22:34470883-34470905 AAGGATAAGAATAAGAAGGAGGG - Intergenic
1182997357 22:34826465-34826487 AAGCAGAAAAAAAAGGAGGCTGG + Intergenic
1183020905 22:35024942-35024964 AAAGAGAAGACAAAGCAGGAAGG + Intergenic
1184001415 22:41676813-41676835 AAGGCAAAGAAAAAGGCTGACGG - Intronic
1184440877 22:44513912-44513934 AGAGAGAAAAAAAAGGAGGAGGG - Intergenic
1184449471 22:44574513-44574535 AAGGAGGAGAAAGAGAAGGAGGG + Intergenic
1184449718 22:44575775-44575797 AAGGGGAAAGAAGAGGAGGAGGG + Intergenic
1185037057 22:48484878-48484900 AAGGAGAAGGAAGAGAAGGAGGG - Intergenic
1185168816 22:49279380-49279402 AAGAGGAAGAAGAAGGAGAAGGG - Intergenic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
1203232754 22_KI270731v1_random:125356-125378 AAGGCAAAGAAAGAGCAGCAAGG + Intergenic
1203278951 22_KI270734v1_random:113131-113153 AAGGCAAAGAAAGAGCAGCAAGG + Intergenic
1203285102 22_KI270734v1_random:150774-150796 GAGGCCATGAAAAAGGAGCAGGG + Intergenic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949365713 3:3278397-3278419 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
949511051 3:4767447-4767469 AAAGAGAAGAAAAAGAAGAATGG + Intronic
950080195 3:10216460-10216482 AAGAGGAAGGCAAAGGAGGAGGG + Intronic
950174488 3:10863238-10863260 AGGGCTAAGTAGAAGGAGGAAGG + Intronic
950215028 3:11153359-11153381 GAGGCCAAGAAAAAGGACCATGG + Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
951162839 3:19446785-19446807 AGGGGGAAGAAAAAGGAGAAAGG + Intronic
951653873 3:24982640-24982662 AAAGAGGAGAAAAGGGAGGAGGG - Intergenic
951729598 3:25796061-25796083 AAGGAGAAGATAAAGAAGGAAGG + Intergenic
951841209 3:27036108-27036130 AAAGAAAAGAAAAAGAAGGAAGG + Intergenic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
951911652 3:27756214-27756236 ACGGAGATGAAAGAGGAGGAAGG + Intergenic
952008836 3:28875725-28875747 AAGGAGAAGAAATAGTGGGAAGG - Intergenic
952046488 3:29327486-29327508 AAGGAGGAGGAAAAGGAGGAAGG - Intronic
952089295 3:29865015-29865037 AAGGGGAAGGAGAAGGAGGGAGG + Intronic
952171142 3:30808123-30808145 AGAAGGAAGAAAAAGGAGGAGGG + Intronic
952241201 3:31532886-31532908 AGGAGGAAGAAAAAGGAGGAGGG - Exonic
952330156 3:32357308-32357330 AAGATAAAGAAAAAGAAGGAAGG - Intronic
953191373 3:40691042-40691064 AAGTAGATGAAAAAGGAGGTGGG + Intergenic
953274233 3:41479204-41479226 CAGGGGAGGAAAAAGGAGAAGGG - Intronic
953338602 3:42115308-42115330 AGGGCAAAGGAAAGGGAGGAAGG - Intronic
953448422 3:42986966-42986988 AAAATGAAGAGAAAGGAGGAAGG - Intronic
953700958 3:45195407-45195429 AAAGAGAAGGAAAGGGAGGAAGG - Intergenic
953903722 3:46857793-46857815 AAAAGGAAGAAAAAAGAGGAGGG + Intergenic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954038456 3:47866404-47866426 GAGGGGAAGAAAAAGGAGGAAGG + Intronic
954440831 3:50521151-50521173 AAGGCCAAGAGAGAGGAGGAGGG + Intergenic
954520960 3:51225878-51225900 AAGGCAGAGAAAAAGGCTGATGG - Intronic
954550885 3:51480668-51480690 CAGGATGAGAAAAAGGAGGATGG - Intronic
954800290 3:53183304-53183326 AAGACTAAGAAAAATGGGGAGGG - Intronic
955006845 3:54976597-54976619 AAGAAGAAGAATAAGGAGGATGG - Intronic
955274306 3:57533057-57533079 AAGGGGAGGGAAAAGTAGGAAGG - Intronic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
955545959 3:60030506-60030528 AATGGGAAGAAAAGGAAGGAGGG - Intronic
955643864 3:61115402-61115424 AAGGCCAAGCACAAGGAGGCTGG + Intronic
955660124 3:61289865-61289887 GAGGAGAAGAAATAGGACGAAGG + Intergenic
955731873 3:61995763-61995785 AAGAAAAAGAAAAAGAAGGAGGG - Intronic
955756299 3:62228224-62228246 AAAACAAAGAAAAAGGAGGCTGG + Intronic
955961727 3:64347557-64347579 AAGGAAAAGAAAAACGAGGACGG + Intronic
956302228 3:67784631-67784653 CAGGGGAAGAATTAGGAGGATGG + Intergenic
956361419 3:68452041-68452063 AAGGCCAAGAGAGGGGAGGATGG + Intronic
956547776 3:70424958-70424980 GAGGAGGAGAAAAAGAAGGAGGG + Intergenic
956587879 3:70883459-70883481 CAAGCCAAGAAAAAGCAGGAAGG + Intergenic
956871223 3:73420247-73420269 AAGGGGAACAAAACAGAGGATGG - Intronic
956952264 3:74296253-74296275 GAGGAGAAGAAAAATGAGGGAGG + Intronic
957235814 3:77588893-77588915 TTGGCGAAGAAAGAAGAGGAAGG + Exonic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
957475066 3:80711746-80711768 AATGGAAAGAAAAAGAAGGAGGG + Intergenic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
958144965 3:89612428-89612450 AGGGAGAAAAAAAAGAAGGAAGG - Intergenic
958144990 3:89612538-89612560 AAGGAGAAAAAAAGGAAGGAAGG - Intergenic
958481359 3:94649078-94649100 AAGGTCAGGAAAATGGAGGATGG + Intergenic
958762392 3:98325124-98325146 AAAGCAAAGAAAACGGAAGATGG - Intergenic
958856994 3:99397673-99397695 AAGGAAGAGAAAGAGGAGGAGGG - Intergenic
958867652 3:99519655-99519677 AAGGGGAAGGCAGAGGAGGAGGG + Intergenic
958867658 3:99519684-99519706 AAAGAGGAGGAAAAGGAGGAGGG + Intergenic
958923228 3:100129348-100129370 AAGGGGAAGAAGAAGGTTGAAGG + Intronic
959007527 3:101037147-101037169 AAGGCAAAGAAAATGCAGAATGG + Intergenic
959034672 3:101346992-101347014 AGGAGGAAGAAAGAGGAGGAAGG + Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959369061 3:105500275-105500297 AAGGAGATGAGAAAAGAGGAAGG - Intronic
959502754 3:107125267-107125289 AAGGAGAAGAAAAAAAAGGGGGG + Intergenic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
959963810 3:112332213-112332235 AAGACGAAGGAGGAGGAGGAGGG + Intergenic
960061546 3:113328035-113328057 ATGGTGAAGAAATAGGTGGAAGG - Intronic
960123261 3:113969041-113969063 AAAGCAAAGAAAAAGGGGGAGGG + Intronic
960273447 3:115699541-115699563 AATGGGAGGAAAGAGGAGGAGGG - Intronic
960427825 3:117530790-117530812 AAGGAGAAGAAAGATGAAGAGGG - Intergenic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960672845 3:120168912-120168934 AATGGGAAGAACAAGGAGAAGGG + Intronic
961282511 3:125775020-125775042 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
961345308 3:126260187-126260209 AGGGGGAAGAGAAGGGAGGAAGG - Intergenic
962334468 3:134514375-134514397 AAGGAGAAAAAAAATGAGAATGG + Intronic
962440776 3:135413968-135413990 AAGAAAGAGAAAAAGGAGGAGGG + Intergenic
962483089 3:135814764-135814786 AAGACAAAGAAAAAGAAAGAAGG + Intergenic
962748618 3:138416691-138416713 AAGTGAAAGAAAAAGGAGGAGGG - Intergenic
962759062 3:138492409-138492431 AAGGGGAAGGAAGAGCAGGAAGG - Intergenic
962865938 3:139448083-139448105 AGGAAGAAGAGAAAGGAGGAAGG - Intergenic
962927928 3:140012204-140012226 AATGCCAAGAGAAGGGAGGAAGG + Intronic
962937331 3:140092919-140092941 ATGGCCAAGAACAAGGATGAGGG + Intronic
963049325 3:141128034-141128056 GAGGAGAAGAAAAAGAAGGCTGG + Intronic
963559906 3:146851307-146851329 AAGATGAAGGAAAAGGAGAAAGG + Intergenic
963794368 3:149616900-149616922 AAGTGGAAGAAAAAGTAAGAAGG + Intronic
964117161 3:153148347-153148369 AAGGAGAAATAAAAGGAGAATGG - Intergenic
964158549 3:153617309-153617331 AAGGAGAAGAGGAAGGAGGCAGG - Intergenic
964236002 3:154528592-154528614 AAGAAAAAGGAAAAGGAGGAAGG - Intergenic
964374387 3:156035364-156035386 AGGAGGAGGAAAAAGGAGGAAGG - Intergenic
964537109 3:157735079-157735101 AAGGCAGAGACAAAGGAGAAAGG + Intergenic
964564316 3:158033112-158033134 AAGAAGAAGAAAAAGAAGGGTGG + Intergenic
964826599 3:160835131-160835153 AAAAGGAAGAAAAAGGAAGAAGG - Intronic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
965114197 3:164466423-164466445 AATTCCAAGAAAAAAGAGGAGGG - Intergenic
965166710 3:165203348-165203370 AAGTCGAAGGAAAAGCAAGATGG - Intergenic
965172184 3:165279927-165279949 GAGGTGAAGAAGAAGGAGGAGGG - Intergenic
965380679 3:167983603-167983625 AAGGAGAAGAAAGAGTGGGAAGG + Intergenic
965410746 3:168327424-168327446 AAGGAGAAGAAAAACGTGTAGGG - Intergenic
965440721 3:168710402-168710424 TAGGCTAAGAAGAAGAAGGAGGG - Intergenic
965803548 3:172518513-172518535 ATGGGGAGGAAAAAGGAGAAGGG - Intronic
965888099 3:173474129-173474151 AAGGAAAAGGAAAAGGAGGAGGG - Intronic
966248404 3:177834477-177834499 AAGGAGAACAAAGAGGAGGGTGG + Intergenic
966266225 3:178047721-178047743 AAGGAGAAAGGAAAGGAGGAAGG + Intergenic
966371933 3:179259916-179259938 AGGGTGAAGAAAAAGGATTAAGG - Intronic
966473540 3:180319331-180319353 AAGGGGAAGTAAGATGAGGATGG - Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
966598035 3:181745028-181745050 AAGGGGAAGAGAGAGAAGGAAGG - Intergenic
966767405 3:183475674-183475696 AAGGAGAAGAAAAATGTAGATGG + Intergenic
966775329 3:183538410-183538432 ATGGTGAAGAAATAAGAGGAAGG - Intronic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
966973663 3:185067300-185067322 AAAGGGAAGAAAAAGGCGCAGGG - Intergenic
967060230 3:185865707-185865729 AAGGCTAAGAAAAATAAGCATGG + Intergenic
967147036 3:186615138-186615160 AGGGAAAAGAAAACGGAGGAAGG + Intronic
967274301 3:187758816-187758838 AGGGGGAAGAAAGAGGAAGAAGG - Intergenic
967341708 3:188405910-188405932 GAGGAGGAGGAAAAGGAGGAAGG - Intronic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967365483 3:188681660-188681682 AAGGAGAAGGAAAAGGAGGGAGG + Intronic
967478621 3:189949313-189949335 AAGGGGAAGAGAAGGGAAGAGGG - Intergenic
967627126 3:191699735-191699757 AAGGAAGAGAAAAAGGAGGAGGG + Intergenic
967932690 3:194701945-194701967 AAGAAGAAGAAAAAGAAGAAAGG - Intergenic
967987683 3:195107507-195107529 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
968677890 4:1894933-1894955 TGGGGGAAGAAAAAGGAGGATGG - Intronic
969015216 4:4099377-4099399 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
969154527 4:5198696-5198718 AAGAGGCAGATAAAGGAGGAAGG + Intronic
969738718 4:9008874-9008896 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
969797922 4:9540519-9540541 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
969920060 4:10530026-10530048 AAGGTGAAAGAAAGGGAGGAAGG - Intronic
969954804 4:10877995-10878017 AAGGAGGAGGAAAAGGAGGAAGG - Intergenic
969955206 4:10882414-10882436 AAGAAGAAGAAAAAGGAAGAGGG - Intergenic
969979526 4:11140470-11140492 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
970095399 4:12458338-12458360 GAGGGGAAGAAAAAAGAGTAGGG - Intergenic
970274619 4:14385141-14385163 TGGGAGAAGAAAAAGGAGGAGGG - Intergenic
971341391 4:25772638-25772660 AAGGGAAAGAAAAGAGAGGAAGG + Intronic
971394290 4:26214343-26214365 AAAAGGAAGAGAAAGGAGGAAGG + Intronic
971420251 4:26467893-26467915 GAGGGGAAGAAGAAGAAGGAGGG + Intergenic
971444825 4:26732025-26732047 AAGAAGAAGAAAAAATAGGAAGG - Intronic
971488623 4:27188010-27188032 GAGGCTAGGAAAAAGGAGGCTGG - Intergenic
971594330 4:28509593-28509615 AAGGGAAAGAAAGAGAAGGAAGG - Intergenic
971633841 4:29031426-29031448 GAGGAGGAGAAAGAGGAGGAGGG - Intergenic
971799205 4:31266652-31266674 TAGTAGAAGAAAGAGGAGGATGG - Intergenic
972796094 4:42421189-42421211 TAGATGAAGAAAAAGGTGGAGGG + Intronic
972897476 4:43641317-43641339 GAAGAGAAGAAAAAAGAGGAGGG - Intergenic
973124445 4:46566917-46566939 AAGAAGAAGAGAAGGGAGGAAGG + Intergenic
973155571 4:46947567-46947589 AAGGCGCAAAAAAGGAAGGAAGG + Intronic
973713224 4:53649967-53649989 ACAGAGAAGAAAAAGGAGCAGGG + Intronic
973832603 4:54776791-54776813 AGAGCCAAGAAATAGGAGGAAGG + Intergenic
973885773 4:55319417-55319439 ACTAAGAAGAAAAAGGAGGAGGG + Intergenic
974323535 4:60385358-60385380 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
974809504 4:66927827-66927849 AAGGAGAAGAAAAAAGAAAAGGG + Intergenic
975028215 4:69578513-69578535 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
975639713 4:76487871-76487893 AAGGCCAAAAGAAAGAAGGATGG - Intronic
976355362 4:84110881-84110903 CAAGGGAGGAAAAAGGAGGAAGG - Intergenic
976437562 4:85035434-85035456 AAAGCTAAGGAAAGGGAGGAAGG - Intergenic
976561967 4:86511893-86511915 AAGGAGAAGAATGAGGAGGAAGG + Intronic
976615273 4:87069631-87069653 AAGGAGAAGAGAAAAAAGGAAGG - Intronic
976894839 4:90097036-90097058 AATGCCAAGAAAAAGTAAGAAGG + Intergenic
976982126 4:91244186-91244208 AAGGGGAAGGAAAAGTGGGAAGG + Intronic
977373839 4:96174350-96174372 AGGGAGGAGAAAAATGAGGAGGG - Intergenic
977455329 4:97252510-97252532 GAAGGGAAGAAAAAGGAGGGTGG - Intronic
977476724 4:97519829-97519851 GAGATGAAGAAAAAGGAGAAAGG + Intronic
977694434 4:99950404-99950426 CAAGCGAAGAAAAGGGTGGAGGG + Intergenic
977728070 4:100320798-100320820 AAGGAGAAGGGAAGGGAGGAAGG - Intergenic
978021240 4:103815487-103815509 AAGGAGAAGAAAAAAGAGAAGGG - Intergenic
978112472 4:104978979-104979001 AAGGGGAGGAAAGAGTAGGAAGG + Intergenic
978400725 4:108327707-108327729 AAGGAGAAGAAGAAGGAAGTAGG - Intergenic
978566666 4:110089855-110089877 AAGGAAAAGAAAGAGGAGGAAGG + Intronic
978572786 4:110157121-110157143 AAGGCCAAGAAGAAGGAGGAGGG + Intronic
978595898 4:110376871-110376893 AAGGTGGAGGAACAGGAGGAAGG - Intronic
978623094 4:110654160-110654182 AAAAAGAAAAAAAAGGAGGAGGG - Intergenic
978922473 4:114201020-114201042 GAAGAGAAGAAAAAGTAGGAAGG - Intergenic
979278612 4:118839907-118839929 AAGGCCAAAAAAAAGGCTGAAGG + Intergenic
979375455 4:119941502-119941524 GAGGAGGAGAAAGAGGAGGAGGG - Intergenic
979851180 4:125573117-125573139 AAGGGGAGGAAAAAGGGGGAAGG - Intergenic
979972907 4:127159677-127159699 AAGGGGAAGGAAAGAGAGGAAGG + Intergenic
980017216 4:127663817-127663839 TAGGAAAAGAAAAAAGAGGAAGG + Intronic
980121189 4:128730224-128730246 AAGGGGAAGAGAAGGAAGGAGGG - Intergenic
980156333 4:129111660-129111682 AAAGCAAAGAAAAAGAAGGTGGG - Intronic
980209796 4:129772529-129772551 AAGGCAAAGAAAGAGAAGCAAGG + Intergenic
980420066 4:132547401-132547423 AAGGAGGAGGAAGAGGAGGAAGG - Intergenic
980454557 4:133022493-133022515 AAGCCGAAGAAGAAGGAAGCTGG + Intergenic
980713831 4:136606414-136606436 GAGGGGAAGACAAAGGAAGATGG + Intergenic
980807082 4:137828130-137828152 AAGGGGAAGAAAGGGAAGGAAGG + Intergenic
980807098 4:137828178-137828200 AAGGGGAAGAAAAGGAAGGAAGG + Intergenic
980807110 4:137828216-137828238 AAGGGGAAGAAAAGGAAGGAAGG + Intergenic
980833034 4:138154741-138154763 AAGAAGAAGAAGAAGAAGGATGG - Intergenic
981254379 4:142644235-142644257 AAGGAGGAGAAAGAGAAGGAAGG + Intronic
981271569 4:142851610-142851632 AAGGCGAAGGAAAAATGGGAGGG + Intergenic
981305719 4:143244971-143244993 AAGGCAAAGAATAAGGTTGATGG - Intergenic
981329266 4:143488971-143488993 AAGGGGAAGAAAGAGTGGGAAGG + Intergenic
981359116 4:143827195-143827217 AAGGTGAAGAAAAAAGAGCCAGG - Intergenic
981369900 4:143948097-143948119 AAGGTGAAGAAAAAAGAGCCAGG - Intergenic
981379479 4:144056498-144056520 AAGGAGAAGGAAAAGGAAGTTGG + Intergenic
981379643 4:144058051-144058073 AAGGTGAAGAAAAAAGAGCCAGG - Intergenic
981557213 4:146008359-146008381 AAAGGGAAGAGAAGGGAGGAAGG - Intergenic
981735206 4:147942581-147942603 AAGGGGCAGGAGAAGGAGGACGG - Intronic
981756508 4:148145979-148146001 AGTGAGAAGAAAAGGGAGGAGGG + Intronic
981769357 4:148289771-148289793 AAGGAAAAGAAAAGGGAGGAAGG - Intronic
981917156 4:150046983-150047005 AAGCTGTAGAAAGAGGAGGAGGG - Intergenic
981950707 4:150403549-150403571 AAGGAGAAGGGAAAGGAGAAGGG - Intronic
982109810 4:152043859-152043881 AAGGAAAGGAAGAAGGAGGAAGG - Intergenic
982115262 4:152093738-152093760 ACATTGAAGAAAAAGGAGGAAGG + Intergenic
982274861 4:153628319-153628341 AAAGAGAAGAAAAATGAGGGAGG - Intronic
982406708 4:155028714-155028736 AAGAAGAGGAAAAAGGAAGATGG - Intergenic
982554501 4:156842055-156842077 AACACGAAGAAAAAAGAGAAAGG + Intronic
982632357 4:157846675-157846697 AAGGAGAGGAATAAGGAGAATGG + Intergenic
982804924 4:159751548-159751570 TAGACTAAGAAAAAGGAAGAAGG - Intergenic
982870374 4:160572655-160572677 AAGCCCAAGAAAGAGGAGGAAGG + Intergenic
982959169 4:161814102-161814124 AAGGGGAAGAGAAAGATGGAAGG + Intronic
983089830 4:163490109-163490131 AAAGAGAAGAAAAGGAAGGAAGG - Intergenic
983449388 4:167891536-167891558 AAGGAGAGGAAAAAAGAGGTGGG + Intergenic
983547498 4:168979102-168979124 AAGGAGGAGTAACAGGAGGAGGG - Intronic
984218399 4:176943177-176943199 AAAGAGGAGAAAAAGGAGGAGGG - Intergenic
984725165 4:183013456-183013478 AAGAAGAAGAAGAAGGAGAAGGG - Intergenic
985679992 5:1250920-1250942 AAAGAGAAGAAGAAGGAAGAAGG - Intergenic
985756642 5:1723427-1723449 GAGGAAAAGAGAAAGGAGGAGGG - Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986439315 5:7764876-7764898 AATGCAAAGAAGACGGAGGAAGG + Intronic
986468391 5:8050063-8050085 AAGGGGAAGGAAAGGAAGGAAGG + Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986837781 5:11660214-11660236 AAGGCCATGAAAAAGGATGGGGG + Intronic
986946669 5:13029303-13029325 AAGGGGAAGAAGAAGGGGAAGGG + Intergenic
986946681 5:13029336-13029358 AAGGGGAAGAAGAAGGGGAAGGG + Intergenic
987042771 5:14078312-14078334 AAAGAGAAGAAAAAAGAGCAAGG - Intergenic
987246342 5:16053077-16053099 AAAGGGAAGAAAAAGGAAGAGGG - Intergenic
987457955 5:18170057-18170079 AAGGGGAAGAAAGAGTGGGAAGG + Intergenic
987575789 5:19726193-19726215 AAAGAGATGAAAAAGGAAGAAGG + Intronic
987865362 5:23528951-23528973 AAACAGAAGAAAAAGGAGAAAGG + Intergenic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988089626 5:26519794-26519816 AAGGAGAAGGAAAAAGAAGAAGG + Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988211990 5:28215862-28215884 AAGGAGGAGAAGAAGGAGGTGGG - Intergenic
988222805 5:28370953-28370975 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
988444587 5:31271398-31271420 AAGGTTAAGACAGAGGAGGAAGG - Intronic
988456849 5:31394413-31394435 AAGGCTAAGAAAAATGAAGCTGG - Intergenic
988774594 5:34466616-34466638 AAGGTCAGGAAAATGGAGGATGG - Intergenic
988890959 5:35617174-35617196 AAGAGGAAGAAAAAGAAGAAGGG - Intergenic
988914656 5:35880402-35880424 AAGAACAAGAAAAAGTAGGAAGG - Intergenic
989122893 5:38021741-38021763 AAGGAGAATAGAAAGGAAGAAGG - Intergenic
989152278 5:38311790-38311812 AAGGCAAAGAAACAGAAGGAAGG + Intronic
989256360 5:39369792-39369814 AAGGAAAAGAAAAGGGGGGAAGG - Intronic
989299763 5:39876972-39876994 ATGGCAGAGAAAAAAGAGGAAGG + Intergenic
989488167 5:42016355-42016377 AAGGAAAAAAAAAAGGAGGGAGG - Intergenic
989566058 5:42902605-42902627 AAAGAAAAGAAAAAGAAGGAAGG + Intergenic
990537992 5:56742731-56742753 AAGGAGAAGAAGAAGAAGGGGGG - Intergenic
990549141 5:56855113-56855135 GAGGAGGAGAAAAAGGAGGAGGG - Intronic
990613232 5:57481348-57481370 TAGGCAAAGAAAAAGGAATATGG + Exonic
990974787 5:61549905-61549927 AAGGCCAGGAAAAATCAGGAAGG - Intergenic
991007955 5:61849503-61849525 CAGGCTAAGAAAAAAGAGAAAGG + Intergenic
991092681 5:62708165-62708187 AAGGGGAAGAGACAGGATGAGGG + Intergenic
992079120 5:73217349-73217371 ATGGCCCAGGAAAAGGAGGAGGG + Intergenic
992090672 5:73313080-73313102 AAGGAGGAGGAAGAGGAGGAAGG - Intergenic
992540585 5:77760379-77760401 AAGGAAAGGAAAAAGGAGGAAGG - Intronic
992629661 5:78667956-78667978 AAGGGGAAGAAAAAGGAGGAGGG - Intronic
992823884 5:80528287-80528309 AAGGGGGAAAAAAAGAAGGAAGG + Intronic
993012669 5:82501263-82501285 AAGGTGCAGAAGAAGGTGGAAGG - Intergenic
993032265 5:82718331-82718353 AAGGAGAAAAGAAAGAAGGAGGG + Intergenic
993199800 5:84800755-84800777 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
993346923 5:86795719-86795741 AAGGAGAAAACAAAGGAGGAAGG + Intergenic
993831914 5:92770735-92770757 AAGGGGAAGAGAAAGGGGAAGGG + Intergenic
993875821 5:93305505-93305527 AAGGAGAAAAAGAGGGAGGAAGG + Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994372734 5:98985775-98985797 AAGGGAAAAAGAAAGGAGGAAGG + Intergenic
994412071 5:99419538-99419560 AAGGAAAGGAAAAAGGAGGGAGG - Intergenic
994481753 5:100345722-100345744 AAGGAAAGGAAAAAGGAGGGAGG + Intergenic
994591242 5:101775351-101775373 AAGGAAAAGAAAAAATAGGAAGG - Intergenic
994591727 5:101782668-101782690 AAAGGTAAGAAACAGGAGGAAGG + Intergenic
994840169 5:104913780-104913802 AAAGAAAAGAAAATGGAGGAGGG + Intergenic
995082267 5:108066070-108066092 AAAGCTAAGAAGAAGAAGGAGGG + Intronic
995541987 5:113194674-113194696 AAGAGGAAGAAAAAGAAGAAAGG + Intronic
995701115 5:114937071-114937093 AAGGCTGAGAAAAGGGAAGAAGG + Intergenic
995830564 5:116350420-116350442 AAGGAGGAGGAAGAGGAGGAGGG + Intronic
996053772 5:118962597-118962619 ATGGAGAAGAAAAAGGAAGTGGG + Intronic
996152253 5:120053554-120053576 AAGTTGAAAAAAAAGAAGGAAGG - Intergenic
996408585 5:123130364-123130386 AAAGAGAGAAAAAAGGAGGAGGG - Intronic
996656095 5:125938386-125938408 AAGGCGAAGGAGAAGGAAGAAGG - Intergenic
996947448 5:129087713-129087735 AAAGAGAAGAAAAAGGAGGCAGG + Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997718161 5:136057452-136057474 GTGGCTAAGAAAAATGAGGAAGG + Intronic
997739906 5:136244193-136244215 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
997791442 5:136766002-136766024 AAGGGGAGGAAGCAGGAGGATGG - Intergenic
997827913 5:137124120-137124142 AAGACGAAGAAAATGGTGCAAGG + Intronic
997853379 5:137352630-137352652 AAGACGAGGAAGAAGGAGGGAGG + Intronic
998288869 5:140892897-140892919 AGGGTGAAGGAAAAGGAGGATGG - Intronic
998519362 5:142785853-142785875 AAGGGAAAGAAAAAGAAGGGAGG - Intronic
998704355 5:144741311-144741333 TAGGAGAAGAAAAGGAAGGATGG - Intergenic
999015312 5:148097060-148097082 AAGAAAAAGAAAAAGGAGAAAGG - Intronic
999101502 5:149029302-149029324 AGGGCGAATAAAAAGGAGCAAGG + Intronic
999402214 5:151273938-151273960 AAAGGGAAGAAAAAGGGGGTGGG - Intergenic
999592745 5:153166819-153166841 AAGGCCAATAAAAGGGGGGAGGG - Intergenic
999712115 5:154328078-154328100 AAGGGGAAAAAAAAAAAGGAGGG + Intronic
999860494 5:155640510-155640532 AAGGGGAAGAGAAAAGAGGAAGG - Intergenic
999889364 5:155960116-155960138 AGGGAGAAGAAAAAGGAGGGAGG - Intronic
999968364 5:156833877-156833899 AGGGCTAGGAGAAAGGAGGAAGG + Intergenic
1000242894 5:159425062-159425084 AAGGCAAACAACAAGGTGGAAGG - Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000266343 5:159641574-159641596 AAGGAGAAAAGAAAGAAGGAAGG + Intergenic
1000534930 5:162468431-162468453 GAGGCAAAGAAAAAGGAATATGG + Intergenic
1000633656 5:163619054-163619076 ATGAAGAAGAAAAAGGAAGAGGG - Intergenic
1000772616 5:165375321-165375343 AAGGCGAGAAGAAAGTAGGAAGG + Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001330210 5:170756672-170756694 AAGGGTAAGGAAAAGGAGGTTGG + Intergenic
1001593406 5:172881884-172881906 AGGGTGAAGAGAATGGAGGAGGG - Intronic
1001685303 5:173590238-173590260 AAGGAAAAGAGAAAAGAGGAAGG + Intergenic
1001787231 5:174424339-174424361 CAGGCCCAGAAAGAGGAGGAGGG - Intergenic
1002203724 5:177548086-177548108 AAAGAGAAGAAAAAGGCAGAAGG - Intronic
1002371440 5:178758157-178758179 AAGGCAGGGAAAAAAGAGGATGG + Intergenic
1002718033 5:181240836-181240858 AAGGCAAAGAAAGCGGGGGACGG + Intronic
1002829172 6:803455-803477 AAGTAGAAGAAAAAGAAGGACGG - Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003145740 6:3508847-3508869 AAACAGAAGAAAAATGAGGAGGG - Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003831996 6:10021875-10021897 AAGGCGAGGAAAAAGGGAGAGGG - Intronic
1003846136 6:10175245-10175267 ATGGAGAAGAAAAGGCAGGAAGG - Intronic
1003990708 6:11483587-11483609 AGGGAGCAGAAACAGGAGGAGGG - Intergenic
1004026633 6:11825690-11825712 GAGGCGGGGAAAATGGAGGATGG + Intergenic
1004109726 6:12705122-12705144 AAGGAGGAGAAAAGGGAGGGAGG + Intergenic
1004199391 6:13533804-13533826 AAGGAGAAGACAGAGGAAGAAGG + Intergenic
1004313272 6:14564582-14564604 GAGTCAAAGTAAAAGGAGGATGG + Intergenic
1004365568 6:15009663-15009685 ACGAGGAAGAGAAAGGAGGACGG - Intergenic
1004404979 6:15324478-15324500 AAGAAGAAGAAAAAGGAGGGGGG - Intronic
1004482655 6:16035651-16035673 AAGAGAAAGAAAAAGAAGGAAGG + Intergenic
1004577029 6:16906831-16906853 GAGGAAAAGAAAAAGAAGGAAGG + Intergenic
1004945583 6:20609260-20609282 AAGGAGGAGAAGGAGGAGGAAGG - Intronic
1005081954 6:21965396-21965418 GAGGAGGAGAAGAAGGAGGAGGG - Intergenic
1005214064 6:23504429-23504451 CAGGAGAACAGAAAGGAGGAAGG - Intergenic
1005285005 6:24315867-24315889 AAGGAGACCAAAAAGGAGGCTGG + Intronic
1005401505 6:25439074-25439096 AAAGAGAAGAAAAACAAGGATGG + Intronic
1005992373 6:30911397-30911419 GAGGCAGAGACAAAGGAGGAGGG - Intronic
1006063390 6:31442356-31442378 AGGAGGAGGAAAAAGGAGGAGGG + Intergenic
1006078728 6:31551588-31551610 AAGGAAAAGAAAAAGGAAGCTGG - Intronic
1006196746 6:32247846-32247868 AAGGCAAAGACAAAGGAAGATGG - Intergenic
1006216643 6:32449331-32449353 AAGAGAAAGAAAAAGAAGGAAGG + Intergenic
1006244502 6:32718703-32718725 AAGGAAGAGAAAGAGGAGGAAGG + Intergenic
1006274873 6:32995710-32995732 AAGGAGGAGAGAAAGGATGAAGG - Intergenic
1007326006 6:41060123-41060145 AAGGAGAAGAAAAAAGAGAAGGG - Intronic
1007806658 6:44455378-44455400 TGGTGGAAGAAAAAGGAGGATGG + Intergenic
1007828922 6:44623225-44623247 AGAAAGAAGAAAAAGGAGGAAGG - Intergenic
1007908678 6:45490489-45490511 AAGGCAATGAAAAAGGAGACAGG + Intronic
1008008967 6:46443530-46443552 AAGGAGAAGAAAAGGGAGATGGG - Intronic
1008397775 6:51028642-51028664 AAGGTCAAGGAAAAGAAGGATGG + Intergenic
1008444226 6:51569912-51569934 AAAGCGCAGAAAACAGAGGATGG - Intergenic
1008863216 6:56176864-56176886 AAGGGGAGGAAAGAGGAGGAAGG + Intronic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1009674448 6:66799447-66799469 AAGATGAAGAAAAAAGAGTAAGG - Intergenic
1009979293 6:70708110-70708132 AAGGAGAGGAAACAGGAAGAGGG - Intronic
1010108417 6:72195203-72195225 ATGGAGAAGATAAAGAAGGAAGG - Intronic
1010232184 6:73544845-73544867 AAGACGAGGAAAAAGAAAGAAGG - Intergenic
1010267641 6:73885045-73885067 AAGGTAAAGAGAAAGTAGGAAGG - Intergenic
1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG + Intergenic
1010357205 6:74948267-74948289 AAGGAGAGGAAAAGGAAGGAAGG + Intergenic
1010434249 6:75811791-75811813 AAGGAAAAGAGAAAGGGGGAGGG + Intronic
1010478333 6:76317734-76317756 AAGGAGAAAAGAAAGGAGAAAGG - Intergenic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010869684 6:81021997-81022019 AAGAGGAAGAGAAAGGAGAAGGG - Intergenic
1010953562 6:82065356-82065378 AAAGTTAAGAAAAAAGAGGAGGG + Intergenic
1011781901 6:90799038-90799060 AATGGAAAGAAAATGGAGGATGG - Intergenic
1012028669 6:94030040-94030062 AATGGGAGGAAAAAGCAGGAAGG + Intergenic
1012055068 6:94395752-94395774 AAGGAGAGGAGGAAGGAGGAGGG + Intergenic
1012091410 6:94902558-94902580 GAGGAGAAGAAAGAGTAGGAAGG + Intergenic
1012232523 6:96777209-96777231 AAGGAGAAGAAAGAGGGAGAGGG - Intergenic
1012494379 6:99818516-99818538 AAGAAGAAGAAGAAGGGGGAGGG - Intergenic
1012547909 6:100440558-100440580 AAGGCGAGGAGAAAGGGAGATGG + Intronic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1012680768 6:102176062-102176084 AAGGAAAACAAAAAGGAGAAAGG - Intergenic
1012713184 6:102634369-102634391 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1013270562 6:108542040-108542062 AAGGTGAAGATAAAGGGAGAGGG - Intergenic
1013351928 6:109313605-109313627 GAGGAGAAGAAACAGGAGGTAGG + Intergenic
1014687157 6:124515688-124515710 AAAGCGAAGAAAAATGAAGTAGG - Intronic
1014758805 6:125331841-125331863 AAGAAGAAAGAAAAGGAGGAGGG - Intergenic
1015242106 6:131036183-131036205 TAGGCAAAGTGAAAGGAGGAAGG + Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015434971 6:133174743-133174765 AAGAAGAAGACAAAGGAGAAGGG - Intergenic
1015460407 6:133484980-133485002 AAGGCGGTGAATAAGGAGCATGG + Intronic
1015654385 6:135500096-135500118 AAGGCTAAGAAAAATCAGAATGG + Intergenic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1015973550 6:138767045-138767067 AAGGAGAAGAAAGAGAGGGAAGG - Intronic
1016161323 6:140884000-140884022 AAGGGGAAGGAGAAGGAGAACGG - Intergenic
1016645810 6:146406876-146406898 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1017037118 6:150276659-150276681 AAGAGGGAGAAAAAGGAGAAAGG - Intergenic
1017142533 6:151204744-151204766 AAAGGTAAGAGAAAGGAGGAGGG - Intergenic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017399392 6:154041857-154041879 AAAGGGTAGAAAAATGAGGAAGG - Intronic
1017681199 6:156865814-156865836 AAGAAAAGGAAAAAGGAGGAAGG - Intronic
1018727897 6:166627512-166627534 AAGGAGTAGAAAGAGGAGGAGGG - Intronic
1019001422 6:168756355-168756377 AAGATGAAGAAAAAGAAGGTAGG + Intergenic
1019465901 7:1188775-1188797 AAGAAGAAGAAGAAGGAGAAGGG + Intergenic
1019484085 7:1280526-1280548 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1019549245 7:1594006-1594028 GAGGGAAAGAAGAAGGAGGAGGG - Intergenic
1020509678 7:9037893-9037915 AATGCAAAGAAAAAGAAGAAAGG - Intergenic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1020577823 7:9956620-9956642 TAGGAGAGGAAAAAGGTGGATGG + Intergenic
1020611629 7:10404478-10404500 AAGGAAAAGAAAAAGAAAGAAGG + Intergenic
1020887719 7:13840066-13840088 GAGGAGAAAAGAAAGGAGGAAGG + Intergenic
1020923396 7:14293887-14293909 AAAGCAAACAAAAATGAGGAGGG - Intronic
1021289378 7:18823983-18824005 AAGAAGAAGAAGAAGGAGAAGGG + Intronic
1021352965 7:19617704-19617726 AAGGAGGAAAGAAAGGAGGAAGG - Intergenic
1021795716 7:24251923-24251945 AAGGAGAAGAAAGAGGAAAAGGG + Intergenic
1021929792 7:25568890-25568912 AAGTAGAAGAAAAGGCAGGAAGG - Intergenic
1021971042 7:25966539-25966561 AAGGAGGAAAGAAAGGAGGAAGG + Intergenic
1022037814 7:26550591-26550613 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1022311505 7:29200600-29200622 AAAGGGAAGGAAAAGCAGGAAGG - Intronic
1022764045 7:33390093-33390115 AAGGAAAAGGAAAAGAAGGAAGG - Intronic
1022898435 7:34776961-34776983 AAGGAGAAGAAGGAGAAGGAAGG - Intronic
1023028085 7:36070022-36070044 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1023095309 7:36654308-36654330 AAGAAGAAGAAAAAGGAGAGAGG - Intronic
1023502462 7:40865149-40865171 AAGGAGAAAAGAGAGGAGGAGGG - Intergenic
1023521294 7:41052624-41052646 AAGGCCAATGAATAGGAGGATGG - Intergenic
1023565693 7:41521966-41521988 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1023569753 7:41559660-41559682 AGGGCGAGGAAAAATGAGGTTGG - Intergenic
1023581618 7:41690131-41690153 AAGAAGAAGAAAGAAGAGGAGGG - Exonic
1023679055 7:42664857-42664879 AAGGGGGATAAAAAGGAGGCAGG + Intergenic
1023910079 7:44547691-44547713 AAAGAGAAAAGAAAGGAGGAAGG + Intergenic
1024014211 7:45296407-45296429 AAGGAGAAGAAAGAGGTTGATGG - Intergenic
1024217506 7:47259799-47259821 AAAGAAAAGAAAAAGGAAGAAGG - Intergenic
1024233085 7:47377710-47377732 AAGGAGGAGGAAAGGGAGGAGGG - Intronic
1024456707 7:49616285-49616307 AGGGCAAAGAAAAAGTAAGAGGG + Intergenic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1024525288 7:50343236-50343258 AAGGGAAAGAAAAAGGAGGAAGG - Intronic
1024721000 7:52137360-52137382 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1024920580 7:54549882-54549904 AAAGTGAGGAAAAAGGATGAAGG + Exonic
1025556823 7:62319476-62319498 AAAACAAAGAAAAAGAAGGAAGG - Intergenic
1025607550 7:63050288-63050310 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1025828514 7:65030445-65030467 AAGAGGAAGAAGGAGGAGGAGGG + Intergenic
1025837328 7:65106472-65106494 AAGGAAAAGAAAAAGGAAAAAGG - Intergenic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026205680 7:68255344-68255366 AAGACGAAGAAGAGGAAGGAAGG - Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026300152 7:69090634-69090656 AAGGGAAAGAAAGAGAAGGAAGG + Intergenic
1026394396 7:69936873-69936895 AAGGGAGAGAAAAAGGAGAAAGG - Intronic
1026502387 7:70953725-70953747 AAGGCAAAGGAGAAGCAGGATGG + Intergenic
1026508455 7:71006950-71006972 AATAAGAAGAAAGAGGAGGAAGG - Intergenic
1026542790 7:71295403-71295425 AAGGGGAAGAGAAGGGAGAAAGG - Intronic
1026689573 7:72540244-72540266 AAGAGGAAGAAAAAGAAGGCAGG + Intergenic
1026900290 7:74033335-74033357 GAGGGGGAGAAAGAGGAGGAAGG + Intronic
1026915342 7:74116695-74116717 AAAGAAAAAAAAAAGGAGGAAGG - Intronic
1026997272 7:74626003-74626025 AAAAAGAAGAGAAAGGAGGAAGG - Intergenic
1027167258 7:75843832-75843854 AGGGCTAAGAAAAATGAGGCTGG - Intronic
1027384798 7:77648949-77648971 AAGGAGAAGAAAGAGAAGGAGGG + Intergenic
1027471387 7:78578634-78578656 AAGGGAAAGAGAAAGGAAGAAGG + Intronic
1027572759 7:79891458-79891480 AAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1027738840 7:81973565-81973587 GAGGAGAAGGAAAAGGAGGGAGG + Intronic
1027864907 7:83633151-83633173 AGGAGGAAGGAAAAGGAGGAAGG - Intronic
1028046847 7:86130868-86130890 AAGGGGAAGTAAAAAGGGGACGG + Intergenic
1028246840 7:88489607-88489629 AAGAAGAAGAACAAGGAGGATGG - Intergenic
1028308025 7:89290649-89290671 AAGGAGAGGTAAAAGGGGGAAGG + Intronic
1028509653 7:91610175-91610197 CAGGAGAGGAAAAAGGAGGGGGG + Intergenic
1028696374 7:93717712-93717734 AAAGAGAAAGAAAAGGAGGAAGG + Intronic
1028988108 7:97023575-97023597 AAGCGGACGAAAAAGGAGGACGG + Intronic
1029015591 7:97312571-97312593 AAGGAAAAGAAAAGGAAGGAAGG - Intergenic
1029073892 7:97921038-97921060 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1029094882 7:98077226-98077248 AAGAAGAAGAAACAGGAAGAAGG + Intergenic
1029180759 7:98700053-98700075 AAGAAAAAGAAAAAGGAGGGAGG + Intergenic
1029249162 7:99223720-99223742 AAGGGGAAAAAAAGGAAGGAAGG + Intergenic
1029534130 7:101145906-101145928 AAGGGGAAGGAAAGGAAGGAAGG + Intergenic
1029621380 7:101691907-101691929 AAGGAAAAGAGAAAGAAGGAAGG - Intergenic
1029823270 7:103165012-103165034 AAAGCAAAAAAAAAGGATGAAGG - Intergenic
1030175534 7:106649690-106649712 AAGAGGAAGAAGAAGAAGGAAGG + Intergenic
1030451019 7:109710987-109711009 AAGAGGAAGAAAAAGAAGAAGGG + Intergenic
1030740184 7:113100287-113100309 AAGGAGAAAAAAATGAAGGAAGG - Intergenic
1031109009 7:117583008-117583030 AAGTCAAGGAAATAGGAGGAGGG - Intronic
1031168454 7:118260651-118260673 GAGGGGAGGAAAAGGGAGGAAGG - Intergenic
1031213984 7:118867336-118867358 ACAGCTAAGAAAGAGGAGGAGGG - Intergenic
1031586328 7:123535079-123535101 GAGGCGAAGAGACAGGAAGAGGG + Intergenic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031682881 7:124695853-124695875 AAGGGAAAGAAAAAGAAGGAAGG + Intergenic
1031696178 7:124857682-124857704 AAGGGGAAGTGAAAAGAGGATGG - Intronic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1031840972 7:126738830-126738852 AAGAAGGAAAAAAAGGAGGAGGG + Intronic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031926751 7:127646254-127646276 AAAGAAAAAAAAAAGGAGGAGGG + Intergenic
1032457258 7:132082790-132082812 ACAAAGAAGAAAAAGGAGGAAGG + Intergenic
1032620783 7:133529194-133529216 AAGGCAAAGAAGAAGGAGAAAGG - Intronic
1033062047 7:138118839-138118861 AGGGGAAAGAAAAAGAAGGAGGG + Intergenic
1033137384 7:138796696-138796718 GATGGGAATAAAAAGGAGGATGG - Intronic
1033215093 7:139487651-139487673 AAGGGGAAGACAAAGGGGAAGGG + Intergenic
1033397973 7:140993689-140993711 AAGTTGAAGAAAAAGCAAGAGGG - Intergenic
1033457054 7:141512079-141512101 AAAGCGGAGAAACAGGAGGGAGG - Intergenic
1033804342 7:144937470-144937492 AAGGAGAAGGGAAAGGAGAAAGG - Intergenic
1033832587 7:145271469-145271491 AGGAAGAAGAAAAAGAAGGAAGG + Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1033982615 7:147184725-147184747 AAGGAGAAGAAAGAAGGGGATGG + Intronic
1034310251 7:150081320-150081342 AAAGAAAAGAAAAAGGAAGAAGG + Intergenic
1034679191 7:152915745-152915767 AGGAGGAAGAAAAGGGAGGAAGG - Intergenic
1034711745 7:153198745-153198767 AGGAGGAAGGAAAAGGAGGAAGG - Intergenic
1034777392 7:153841413-153841435 AAGGGGATGAAAAAGCAGGTAGG - Intergenic
1034796592 7:154019333-154019355 AAAGAAAAGAAAAAGGAAGAAGG - Intronic
1035278568 7:157763284-157763306 AAGGGAGAGAAAAATGAGGAGGG - Intronic
1035672554 8:1431493-1431515 AAGAAGAAGAGAAAGGAGAAAGG + Intergenic
1035752462 8:2005935-2005957 AACCGGAAGGAAAAGGAGGAAGG - Exonic
1035796836 8:2365608-2365630 AGGGTGAAGAAAAGGGAAGATGG - Intergenic
1035979822 8:4357765-4357787 AATGAAAAGAATAAGGAGGATGG + Intronic
1036243813 8:7100258-7100280 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1036256976 8:7213793-7213815 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036309026 8:7672392-7672414 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036360508 8:8073720-8073742 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1036505040 8:9347462-9347484 AAGGGGAAGGGAAGGGAGGAGGG + Intergenic
1036604511 8:10293738-10293760 AAGGGGAAGGAAAGGGAGGGAGG - Intronic
1036890463 8:12593247-12593269 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036898031 8:12651165-12651187 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1037156760 8:15710111-15710133 AAATAGAAGAAAAAGGAGGTAGG - Intronic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037369754 8:18163116-18163138 AAGGAGAGGAAAAAGTAGAAGGG + Intergenic
1037514114 8:19612511-19612533 AGGCCCAAGAAAAAGGAGGAGGG + Intronic
1037568836 8:20141556-20141578 AAGGGGAAGAAGAAGCAGGGAGG + Intergenic
1037691297 8:21183495-21183517 AAGGAAGAGAAAGAGGAGGAGGG - Intergenic
1037799400 8:22024334-22024356 AAGGCAACGAACAAGAAGGAGGG + Exonic
1037809037 8:22075310-22075332 AAGAAGAAGAAGAAGGGGGAGGG - Intronic
1037944966 8:22983356-22983378 AAGAAGAAGAAGAAGGAGCAAGG + Intronic
1038009408 8:23462902-23462924 AAGAAGAAGAAAGAGAAGGACGG - Intergenic
1038149601 8:24930535-24930557 AAAGGGTAGAAAAGGGAGGAGGG - Intergenic
1038537491 8:28364021-28364043 AAGCAGAAGAGAAAGAAGGAAGG + Intronic
1038974721 8:32681433-32681455 AAGGTGCAGAAGAAGGAGAAGGG - Intronic
1039023117 8:33229082-33229104 AAGGTTGAGAAAAAGGGGGATGG - Intergenic
1039182082 8:34878191-34878213 AAAGAAAAGAAAAAGGAGGGAGG + Intergenic
1039257752 8:35737685-35737707 AAGGCAAAGAAAACAAAGGAAGG - Intronic
1039320755 8:36427861-36427883 AAGGGGAAAAAAAGGGGGGAAGG + Intergenic
1039334871 8:36577680-36577702 AATGCCAAAAAAAAAGAGGATGG - Intergenic
1039436012 8:37559668-37559690 GAGGAGGAGGAAAAGGAGGAGGG + Intergenic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1039513716 8:38112886-38112908 AAAGGGAAGAAAAAGAATGAGGG - Intronic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1039970157 8:42315386-42315408 TAGATGAAGAGAAAGGAGGAAGG + Intronic
1040095916 8:43442382-43442404 AGGAGGAAGAAAAAGGAAGAAGG - Intergenic
1040537178 8:48320625-48320647 AAGGGGAAAATAAAGGAGGAAGG + Intergenic
1040564274 8:48552149-48552171 AAGGAGGAGCGAAAGGAGGAGGG - Intergenic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1040889443 8:52301811-52301833 AATGAGGAAAAAAAGGAGGAAGG - Intronic
1041067045 8:54092093-54092115 AAGGAGAAGGAAGAGGGGGAGGG + Intronic
1041267603 8:56080326-56080348 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1041406243 8:57502313-57502335 AAGGCTTAGAAGAAAGAGGAAGG - Intergenic
1041444142 8:57931774-57931796 AAAGGGAAGGAAAAGAAGGAGGG + Intergenic
1041567274 8:59293115-59293137 CAGGCCAAGAAGAAGGGGGAAGG + Intergenic
1041636375 8:60150541-60150563 AATGGGAAGAAAAAGGAAGGTGG - Intergenic
1041854922 8:62440675-62440697 AAGAAGAAGAAAAAGAAGGAAGG - Intronic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042279171 8:67036775-67036797 AGGGGGAAGAAAAGGAAGGAAGG - Intronic
1042311056 8:67379812-67379834 AAGGAGAAGAAAGAGAAAGAGGG - Intergenic
1042439501 8:68809693-68809715 AAGTGGAGGAAAAAGGAGGTAGG - Intronic
1042487629 8:69363910-69363932 AAGGAGAAGGAAGAGGAGCAGGG + Intergenic
1042553478 8:70014780-70014802 AAGGAGAAGAAAGAAGAAGAAGG - Intergenic
1042555816 8:70033116-70033138 AGGGAGAGGAGAAAGGAGGAAGG + Intergenic
1042712241 8:71731080-71731102 AAGGCTAGGAAAAATGAGGAAGG - Intergenic
1042748301 8:72131537-72131559 AAGGAGAAGAAAAAGGAAGGAGG - Intergenic
1042852748 8:73233107-73233129 AGTGGGAAGAAGAAGGAGGAAGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043123160 8:76357022-76357044 AATGAGAATAAAAAGGAGCACGG + Intergenic
1043385585 8:79744628-79744650 AAGGAGAAGTAAAAGGAGAAGGG + Intergenic
1043587162 8:81782628-81782650 TAGACCAAAAAAAAGGAGGAGGG - Intergenic
1043703341 8:83318491-83318513 AAAAAGAAGAAAGAGGAGGAGGG - Intergenic
1043753781 8:83975727-83975749 AAGAGGAGGAAAAAAGAGGAGGG + Intergenic
1043766246 8:84135753-84135775 AAAGAAAAGAAAAAGAAGGAAGG + Intergenic
1043778982 8:84307688-84307710 ATGGGGAAGAAAGAGGAGCAAGG + Intronic
1043832924 8:85011946-85011968 AAAGAGAAGAAAAGGGAGGAGGG - Intergenic
1044275461 8:90294392-90294414 AGGTAGAAGAAAAAAGAGGAAGG - Intergenic
1044289520 8:90451483-90451505 AAGGAAAAGAAAAAAGTGGAAGG - Intergenic
1044402224 8:91786119-91786141 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044402229 8:91786137-91786159 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044461200 8:92446441-92446463 GAGGCTAAGAAAAGGGAGAAAGG - Intergenic
1044543286 8:93431369-93431391 CAGGCAAGGAAAAAGGAGGCAGG + Intergenic
1044758666 8:95493601-95493623 ATCGAGAAGAAAAAGGAGAAAGG + Intergenic
1044899250 8:96926522-96926544 AAGAAGAAGAAAAAGAAGAAAGG - Intronic
1045042183 8:98236514-98236536 AAGGGGCAGAAAGAGCAGGAAGG + Intronic
1045094276 8:98781439-98781461 AAGGCGAAAAAAAATGACCAGGG + Intronic
1045374480 8:101557695-101557717 AAGGCATGAAAAAAGGAGGAAGG - Intronic
1045669384 8:104530803-104530825 AATGCAAAGAAAAAGGGAGAAGG + Intronic
1045812378 8:106237935-106237957 TAAGAGAAGAAAAAGGAGTAGGG + Intergenic
1045875706 8:106978489-106978511 AAGGAGAGGAAAAAGATGGACGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046063243 8:109164273-109164295 AAGGGGAAGAAAGGGGAGGAGGG + Intergenic
1046114097 8:109764952-109764974 AAGGGGAGGAAAGAGCAGGAAGG - Intergenic
1046236837 8:111435205-111435227 AAGGAAAAGAAAAGGAAGGAAGG + Intergenic
1046538280 8:115544853-115544875 AAGGAGGAGAAGAAGGTGGAGGG + Intronic
1046551947 8:115729140-115729162 AAGGGAAAGAAAGAGAAGGAAGG + Intronic
1046558441 8:115806744-115806766 AAGAAGAAGAAAGAGAAGGAAGG + Intronic
1046698590 8:117373669-117373691 GAGGAGAAGAGAAAGGGGGAGGG + Intergenic
1047112938 8:121811116-121811138 AAGATGAAGGAAGAGGAGGAGGG + Intergenic
1047138299 8:122106774-122106796 AAGGGGAAGGAAGAGTAGGAGGG - Intergenic
1047221538 8:122922608-122922630 GAGGAGAAGGAACAGGAGGAAGG - Intronic
1047464517 8:125099454-125099476 AAGGAGAAGAAAAAGAAGCTTGG + Intronic
1047703998 8:127479193-127479215 AGGGGAGAGAAAAAGGAGGAAGG + Intergenic
1047830116 8:128620326-128620348 AAGGCCTAGAAACAGGAGAAAGG - Intergenic
1047976105 8:130132427-130132449 ATGGCACAGAAACAGGAGGATGG - Intronic
1048224475 8:132571498-132571520 AAGGTGAAGAAAAAGAATAAGGG + Intergenic
1048366412 8:133742589-133742611 AAGGAGAAAAGAAGGGAGGAAGG + Intergenic
1048417597 8:134243792-134243814 AAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1048599648 8:135906230-135906252 CAGGCGAGGAAAAAGGAAGAAGG - Intergenic
1049566498 8:143341816-143341838 AAGAGGAAGAAGAAGGAAGAAGG - Intronic
1049875162 8:145012891-145012913 AAGGCCAAGAAAAAGGAACGAGG - Intergenic
1049904431 9:202880-202902 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1050010425 9:1180316-1180338 AAGGAGAAGAGGAAGCAGGAAGG - Intergenic
1050073922 9:1844247-1844269 AAGGCAAAGATAAAACAGGATGG + Intergenic
1050648352 9:7746771-7746793 AAGCCAAAGAAAAAAAAGGAAGG + Intergenic
1050713091 9:8488036-8488058 AATGTGAAGAAAAAGAAAGATGG + Intronic
1051189256 9:14493797-14493819 AAGGAGAAGAACAAGGAGGGAGG - Intergenic
1051257045 9:15224471-15224493 AAAGAGAAGAGAATGGAGGAAGG - Intronic
1051605879 9:18917445-18917467 AAGGGAAAGAAAAGGGAGGCAGG + Intergenic
1051672735 9:19528488-19528510 AAAAGAAAGAAAAAGGAGGAGGG - Intronic
1052257349 9:26473796-26473818 AAGGTAAAGGAAATGGAGGAAGG - Intergenic
1052540230 9:29802242-29802264 AGGGGGGAAAAAAAGGAGGAGGG - Intergenic
1052732952 9:32310949-32310971 AAAGGGAGGAAAAAGCAGGAAGG + Intergenic
1052898865 9:33772907-33772929 AAGGATCAGAAAAAGGGGGAAGG - Intronic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053037827 9:34840535-34840557 AAGAAGAAGAAGAAGAAGGAAGG - Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053474309 9:38370979-38371001 AAGGCTAAGATAAGGAAGGAGGG + Intergenic
1053486893 9:38465354-38465376 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1053601181 9:39611105-39611127 AAGGAGAAGACCAAGGAGCAGGG - Intergenic
1053698465 9:40661981-40662003 AAAACAAAGAAAAAGAAGGAAGG - Intergenic
1053727003 9:41014454-41014476 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1053858830 9:42364903-42364925 AAGGAGAAGACCAAGGAGCAGGG - Intergenic
1054309754 9:63461382-63461404 AAAACAAAGAAAAAGAAGGAAGG - Intergenic
1054441698 9:65269347-65269369 AAAACAAAGAAAAAGAAGGAAGG - Intergenic
1054566470 9:66765833-66765855 AAGGAGAAGACCAAGGAGCAGGG + Intergenic
1054728297 9:68674875-68674897 AGGGAGAAAAAAAAGAAGGAAGG - Intergenic
1054991429 9:71331751-71331773 AAGGGGGAGAAAAAGGAGAAGGG + Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055370480 9:75593199-75593221 AAGGCAAAGAAAGGGGTGGATGG - Intergenic
1055468740 9:76590976-76590998 AAGGAAAAGAAAAGGGAGAAAGG + Intergenic
1055708252 9:79031885-79031907 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1055723135 9:79197979-79198001 AAGGGGAAAAGAAAGGAGGTAGG - Intergenic
1056073999 9:83019913-83019935 AAGGGGCAAAGAAAGGAGGAAGG + Intronic
1056165547 9:83937409-83937431 GAAGGGAAGAAGAAGGAGGAGGG + Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056691327 9:88811004-88811026 AAGGCCACGTATAAGGAGGAGGG - Intergenic
1057739767 9:97701172-97701194 GAGCCGAAGGAGAAGGAGGAGGG - Intergenic
1058174286 9:101720061-101720083 AAGGGGAGGAAAAAAGAGCAGGG - Intronic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058794656 9:108486323-108486345 GAGGTGAAGAATAAGGAAGAAGG + Intergenic
1058817564 9:108699042-108699064 AAGGGGAAGGGAAAGGGGGATGG + Intergenic
1059354279 9:113687234-113687256 AAGGCAGAGAAGAGGGAGGAGGG + Intergenic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059443903 9:114326325-114326347 AAGGAGAGGAAACAGGAGGAGGG + Exonic
1059445110 9:114333102-114333124 AAGGAGAGGAAACAGGAGGAGGG + Exonic
1059474746 9:114536281-114536303 AAAGGGAAGAAAAGGAAGGAAGG + Intergenic
1059483421 9:114609717-114609739 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1059568112 9:115404097-115404119 AAGGAGAAGAAAAAGAAGAGGGG - Intergenic
1059588319 9:115630103-115630125 AAGCCTAAGGAAAAGGAGGGAGG + Intergenic
1059672293 9:116503016-116503038 AAGGAAAGAAAAAAGGAGGAAGG + Intronic
1059677467 9:116553122-116553144 AAGAAGAAGAAAGAGGAGGAAGG - Intronic
1060476377 9:123989861-123989883 AAGAGGAAAAAAAAGAAGGAAGG + Intergenic
1060700743 9:125747356-125747378 GAGGAGAAGAAAGAGGGGGAGGG - Intronic
1060747517 9:126147287-126147309 AAGGAGAAGAAAATGGGAGAGGG + Intergenic
1060769810 9:126324555-126324577 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062314580 9:135960516-135960538 AAGGGGAAGAGGAAGGAGAAGGG + Intronic
1062480954 9:136751086-136751108 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1062608501 9:137360443-137360465 AAGAAGAAGAAAAGGAAGGAAGG - Intronic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638457 9:137503850-137503872 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638470 9:137504014-137504036 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1202780828 9_KI270717v1_random:35186-35208 AAAACAAAGAAAAAGAAGGAAGG - Intergenic
1203615725 Un_KI270749v1:61923-61945 AAAACAAAGAAAAAGAAGGAAGG + Intergenic
1185479215 X:433677-433699 AAGGCAATGAAGAAGGAAGAAGG + Intergenic
1185523701 X:760960-760982 AAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1185574782 X:1162840-1162862 AAGGAAAAGAAAAGGAAGGAAGG + Intergenic
1185603709 X:1355285-1355307 AGGGGGAGGAAAAAGGAGGAGGG + Intronic
1185610931 X:1393110-1393132 AAGACGGAGAAAAAGGAGGGAGG - Intergenic
1185613730 X:1407793-1407815 ACAGAGAAGATAAAGGAGGAAGG + Intronic
1185662009 X:1735515-1735537 GAGGAGGAGAAAGAGGAGGAGGG - Intergenic
1185680049 X:1881111-1881133 AAGGAAAAGAAAAGGAAGGAAGG + Intergenic
1185680062 X:1881193-1881215 AAGGAAAAGAAAAAGAGGGAAGG + Intergenic
1186058882 X:5681854-5681876 AAGGGAAAGAAAAAAGAGGAAGG + Intergenic
1186064114 X:5743001-5743023 AAGAAGAAGAAAAGGAAGGAAGG + Intergenic
1186077694 X:5898371-5898393 ATGGCGGAGAAAAGGAAGGAAGG - Intronic
1186193236 X:7086642-7086664 AAGGCCTAGAAAAAGGAAGGAGG - Intronic
1186361174 X:8843661-8843683 AATGCGAAGAAAATGGAGGAAGG + Intergenic
1186361441 X:8846105-8846127 AAGGAGAAGGAAGAGGAAGAAGG - Intergenic
1186384697 X:9097853-9097875 GAGGCGAGGAAACAAGAGGAAGG - Intronic
1186908744 X:14139037-14139059 AAGGAGGAGAAGAAGGAGAAGGG + Intergenic
1186924700 X:14320435-14320457 AAGGAGAAGAGAAACAAGGATGG - Intergenic
1187096821 X:16157557-16157579 AAGGCTAAGACAAAGAAGGGTGG + Intergenic
1187242818 X:17528986-17529008 AAAACAAAGAAAAAGAAGGAAGG - Intronic
1187316768 X:18203126-18203148 TGGGGGAAGGAAAAGGAGGATGG + Intronic
1187447672 X:19373147-19373169 GAGAGGAAGGAAAAGGAGGAAGG + Intronic
1187618646 X:21026742-21026764 AAGGGGAAGTAAGAGTAGGAGGG - Intergenic
1187781510 X:22831827-22831849 AGGGGGAAGAAAAAGGAAGATGG - Intergenic
1187843796 X:23515450-23515472 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1188142836 X:26573700-26573722 AAGGAGAATGAAAAGAAGGAAGG - Intergenic
1188254096 X:27938355-27938377 AAGGCAAAGAAATAGTAGAATGG + Intergenic
1188448156 X:30279051-30279073 AAGGAGAAAAAAATGGAAGATGG + Intergenic
1188518231 X:31010458-31010480 AAGGAGAAGAAAAAGTGAGATGG - Intergenic
1188568054 X:31549061-31549083 AAGGCCCATAAAAATGAGGAGGG + Intronic
1188591002 X:31834858-31834880 AAGGAGAAAAAAAAAAAGGAAGG + Intronic
1188741190 X:33784667-33784689 AAGGAAAAGAAAAAGAAAGAAGG - Intergenic
1188895710 X:35665886-35665908 AAGGGGAGGAAAAAAGAGGTAGG - Intergenic
1188980182 X:36720425-36720447 AAGGAGAAGAAGAAGAAGAAGGG + Intergenic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189148844 X:38684052-38684074 AAGGGCAAGAAAAAGGTCGAGGG - Intronic
1189156489 X:38762463-38762485 GAGGAGGAGAAAGAGGAGGAAGG + Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189369181 X:40414269-40414291 AAGGCGAAGGAAATGCTGGAAGG + Intergenic
1189457904 X:41210955-41210977 AAGGAAAAGAAAAAGGAGAAAGG - Intronic
1189481339 X:41394445-41394467 CAGGCACAGAAGAAGGAGGAGGG + Intergenic
1189737780 X:44089096-44089118 GAGAGGAAGAACAAGGAGGAGGG + Intergenic
1189854360 X:45209135-45209157 AAGGGGAAGAAAGAGTAGGAAGG - Intergenic
1190017160 X:46836920-46836942 AGGGCGACGAAAAAGGGGAAGGG + Exonic
1190211334 X:48450969-48450991 AAAAGGAAGAAAAAGAAGGAAGG + Intergenic
1190420982 X:50284185-50284207 AGGGGGAAGAGAAAGGAAGATGG - Intronic
1190568428 X:51755625-51755647 AAAGAGAAGAAAAAGGAACAAGG - Intergenic
1190641020 X:52482761-52482783 AAGGAAGAGGAAAAGGAGGAAGG - Intergenic
1190646652 X:52530104-52530126 AAGGAAGAGGAAAAGGAGGAAGG + Intergenic
1190757408 X:53412942-53412964 AAGGAGAAGAAGAAGGAGCTGGG - Exonic
1190887548 X:54542929-54542951 AAGGAGAAAAAAAAAGAGAATGG - Intronic
1190895345 X:54613126-54613148 AAGACAAAGAAAAAAGAGTAAGG - Intergenic
1192093511 X:68185774-68185796 AAGGCTAAAGAAAAGGAGAAAGG + Intronic
1192135116 X:68589587-68589609 AAGGGGAAGAAAGAGCAGGAAGG + Intergenic
1192143953 X:68668206-68668228 AAGAGAAAGAAGAAGGAGGAGGG - Intronic
1192448960 X:71230903-71230925 AAGGGGAAGGAAGAGGGGGAAGG + Intergenic
1192639091 X:72846163-72846185 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1192642620 X:72874642-72874664 GAGGAGGAGAAGAAGGAGGAGGG - Intronic
1192875184 X:75222559-75222581 AATGGGAGGAAAAAGAAGGAAGG - Intergenic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193215652 X:78860898-78860920 AAGGGGAGGAAAGAGTAGGAAGG + Intergenic
1193601168 X:83509574-83509596 AAGGGAAAGAAAAAGGGGAAAGG - Exonic
1193601701 X:83514390-83514412 GAGGAGAAGAAAGAGGAGAATGG + Intergenic
1193815790 X:86102930-86102952 AAGGGGAAGAAAGAGTGGGAAGG + Intergenic
1193894897 X:87100889-87100911 AAGGGGAAGGAAGAGAAGGAAGG + Intergenic
1193911927 X:87316768-87316790 AAGGGGAGGAAAGAGTAGGAAGG - Intergenic
1194140546 X:90203738-90203760 AAGGTAAAGAGAAAGAAGGAGGG - Intergenic
1194638915 X:96378514-96378536 AAGGAGAAACAAAAGGAGGGTGG + Intergenic
1194841917 X:98753732-98753754 AAGGTGAAAGAAAAGCAGGAAGG - Intergenic
1194847735 X:98832531-98832553 AACAAGAAGAAAAAGGAGGAAGG - Intergenic
1194992950 X:100564183-100564205 AAGGGGAAGAACAAGGGGAATGG + Intergenic
1195030112 X:100918821-100918843 AATAGGAAGAAAGAGGAGGAGGG - Intronic
1195318451 X:103701148-103701170 AGGAAGAAGGAAAAGGAGGAGGG - Intergenic
1195727760 X:107935649-107935671 AAAGGGGAGAAAAAAGAGGATGG - Intergenic
1195964093 X:110414403-110414425 AAGTGGAGGAAAAAGGATGAGGG + Intronic
1195973955 X:110505124-110505146 AAGGAAAAGGAAAAGGGGGAAGG - Intergenic
1196299516 X:114038390-114038412 AAGGCTGAGAAACAGGAGGTTGG - Intergenic
1196762508 X:119212191-119212213 GAGGCCAAGAAAAAAGAGGTAGG + Intergenic
1196865417 X:120066389-120066411 AAGGGGAGGGAAAAGCAGGAAGG + Intergenic
1196877677 X:120169891-120169913 AAGGGGAGGGAAAAGCAGGAAGG - Intergenic
1196942489 X:120791089-120791111 AAGAAGAAGAAAAAGAAAGAAGG - Intergenic
1197165272 X:123370245-123370267 AGGGAGAAGGAAAAGTAGGATGG - Intronic
1197339873 X:125254152-125254174 AAAGGAAAGAAAGAGGAGGAAGG - Intergenic
1197382710 X:125765371-125765393 AAGTGGAAGAAAAAAGGGGAAGG - Intergenic
1197508923 X:127346617-127346639 AAGGAGAGGAAAGAGTAGGAAGG - Intergenic
1197583433 X:128313284-128313306 AAGGCCAAGAAAAAGAAGGTGGG + Intergenic
1197744528 X:129922711-129922733 AAGGAAAAAAAAAAGGAGGCTGG - Intronic
1198015939 X:132610970-132610992 CAGGGGAAGAAAGAAGAGGAGGG + Intergenic
1198139848 X:133791781-133791803 AAGGAAAAGAAAAAGGAAAAAGG - Intronic
1198383379 X:136105077-136105099 AAAGGCAAGGAAAAGGAGGAAGG + Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198871537 X:141180930-141180952 AAGGGGAAAGAAAATGAGGAAGG - Intergenic
1199462359 X:148098697-148098719 AAGGCTAACAAACAGGAGCAAGG + Intergenic
1199841465 X:151653691-151653713 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
1200379716 X:155822221-155822243 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200379724 X:155822245-155822267 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200486305 Y:3772843-3772865 AAGGTAAAGAGAAAGAAGGAGGG - Intergenic
1200912276 Y:8541570-8541592 AAGGCAAAGAGCAAGAAGGATGG + Intergenic
1201300261 Y:12498784-12498806 ATGACGAAGAAGTAGGAGGAAGG - Intergenic
1201389254 Y:13479592-13479614 GAGGCAAAGAAAATGGCGGAAGG - Exonic
1201461518 Y:14230648-14230670 AAGGAGAAAGAAAAGAAGGAAGG + Intergenic
1201541060 Y:15105448-15105470 AAGAAGAAGAAAGAAGAGGAGGG - Intergenic
1201587328 Y:15575515-15575537 AGTGTGAAGATAAAGGAGGATGG - Intergenic
1201726109 Y:17153808-17153830 AAGACCGAGAGAAAGGAGGAGGG + Intergenic
1201888817 Y:18919175-18919197 AAGGTGTAGAAGAAGGAAGAAGG + Intergenic
1202101136 Y:21309236-21309258 AAGGAGAAGAAAAAAGGGAAAGG + Intergenic
1202138168 Y:21688751-21688773 AAGGCAAAGAAAATGCAGAATGG + Intergenic
1202164243 Y:21969636-21969658 ATTGCAAAGAAAAAGGAGAATGG + Intergenic
1202227113 Y:22616736-22616758 ATTGCAAAGAAAAAGGAGAATGG - Intergenic
1202316009 Y:23578918-23578940 ATTGCAAAGAAAAAGGAGAATGG + Intergenic
1202554756 Y:26091149-26091171 ATTGCAAAGAAAAAGGAGAATGG - Intergenic
1202590760 Y:26480839-26480861 CAGGAGAAGAAAGGGGAGGAGGG + Intergenic