ID: 925985210

View in Genome Browser
Species Human (GRCh38)
Location 2:9209528-9209550
Sequence ATGTTTAAACAAATGAATCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 698
Summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 640}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925985210 Original CRISPR ATGTTTAAACAAATGAATCA CGG Intronic
902370764 1:16005557-16005579 ATGAATAAACAAATGAATTCAGG + Intronic
902684695 1:18068356-18068378 ATCTTTAAACGTATGCATCATGG - Intergenic
902741064 1:18438345-18438367 AGGGTTAAACACATGGATCAAGG - Intergenic
903451888 1:23459274-23459296 ATGTTTACCTAAATGAATGATGG + Intronic
904626029 1:31803203-31803225 ATGTTTAAAGAAATAAAAGAAGG + Intronic
904766234 1:32849976-32849998 CTGTTTAAATAAATAAATAAAGG - Intronic
905036868 1:34924351-34924373 ATTTTTAAGCAAAGGATTCAAGG - Intronic
905159004 1:36014835-36014857 ATGTCTAATAGAATGAATCAAGG - Intronic
905314087 1:37070035-37070057 ATCTTTAAAGAAATCAAACAAGG - Intergenic
905477406 1:38238807-38238829 ATGATTAAGTAAATGAATGACGG + Intergenic
906463918 1:46059009-46059031 AAGGTGAAACAACTGAATCATGG + Intronic
906779841 1:48563398-48563420 CTGATTAGACAAATGACTCAGGG - Intronic
906795627 1:48694316-48694338 ATGTTTTAAAAAAAGCATCATGG + Intronic
907125262 1:52044623-52044645 ATGTTTAAAGAAATAACACATGG + Intronic
907726017 1:57021418-57021440 ATGTGGAGATAAATGAATCATGG + Intronic
908097029 1:60749827-60749849 ATTTCTAAACAAATGAATCTGGG - Intergenic
908212349 1:61914139-61914161 CTGTTTAAACAAATACATTAAGG + Intronic
908866741 1:68556397-68556419 AGGTTGAAATAATTGAATCATGG + Intergenic
909229223 1:73063544-73063566 ATCTTTAAACAAATAAAACATGG + Intergenic
909335801 1:74472107-74472129 AGCGTTTAACAAATGAATCATGG - Exonic
909365936 1:74822021-74822043 AGGTTTCAACATATGAATCTGGG + Intergenic
909800343 1:79798287-79798309 AGGTTAAAATAAATGAATAAAGG + Intergenic
909840501 1:80315661-80315683 CTTTTTGAACAAATGAATGAAGG + Intergenic
910120281 1:83780848-83780870 ATTTGCAAACAAATGAATGAAGG + Intergenic
910893450 1:92042185-92042207 ATTTTTAAAAAATTGAAACAGGG - Intronic
911061179 1:93749285-93749307 ATTTTTAAAAATATAAATCATGG + Intronic
911787400 1:101968061-101968083 TTGTTAAAACCAATGCATCATGG - Intronic
912740829 1:112195503-112195525 ACATTTAAAAAAATGTATCAAGG + Intergenic
913628024 1:120679740-120679762 TTGTTTAATTAAATGAATGAAGG - Intergenic
914455306 1:147831328-147831350 ATCTTGAAACAAATAAATCCTGG - Intergenic
914562077 1:148830094-148830116 TTGTTTAATTAAATGAATGAAGG + Intronic
914610753 1:149300127-149300149 TTGTTTAATTAAATGAATGAAGG - Intergenic
915430977 1:155866667-155866689 ATGTTGAAAAAAATTAAGCAAGG + Intronic
915850350 1:159314933-159314955 ATTTTTAAAAAAAGGAACCAGGG - Intergenic
916224981 1:162480600-162480622 GTATTGAAACAAATGAAACATGG + Intergenic
916287490 1:163125792-163125814 AAGTGAAATCAAATGAATCAAGG - Intronic
916740285 1:167641372-167641394 ATCTCTAAATAAATGAATGAAGG - Intronic
916869968 1:168903033-168903055 ATGTTTAAAAGAATGAGTCAAGG + Intergenic
916982123 1:170149381-170149403 AAGTTTAAATGAGTGAATCAAGG - Intronic
917024284 1:170625284-170625306 AGGCTTAAACAAATTAATAAAGG + Intergenic
917550206 1:176019162-176019184 CTTTTTAAAAAAATAAATCATGG + Intronic
917706896 1:177643880-177643902 GAGTTTAAACAAATGACTGAGGG + Intergenic
918329158 1:183440380-183440402 ATGAATAAACAAATAAATTAGGG + Intergenic
919461867 1:197886126-197886148 ATGTTTCAACATATGAATTTGGG + Intergenic
921027913 1:211305570-211305592 ATCTTTAAACAACTGAATACTGG - Intronic
921132234 1:212229711-212229733 ATGTTGAAAGAAATAAATAAAGG - Intergenic
921436130 1:215124900-215124922 AGATTTAAACAAAAGAATAATGG + Intronic
922205014 1:223438546-223438568 AAGTTTCAACACATGAATCTTGG - Intergenic
923658849 1:235941349-235941371 ATATTTAAACAAATGGAGCCAGG - Intergenic
923660520 1:235953090-235953112 GGGTTTAGACAAATGTATCATGG + Intergenic
923773083 1:236954696-236954718 ATTCTTAAACATATTAATCATGG + Intergenic
1062794122 10:330039-330061 ATATTTAAACAAATGAGTGGTGG - Intronic
1062806185 10:421320-421342 ATTTTTGAACAAGTGAATCACGG - Intronic
1062879149 10:964363-964385 ATATTTCAAAAAATGAATCTGGG - Intergenic
1063332048 10:5169428-5169450 ATTTTTAACCAACAGAATCATGG - Intergenic
1063397554 10:5704517-5704539 ATCTTTAGTCAAATTAATCAAGG - Intronic
1064873077 10:19962071-19962093 ATGTGGAAAGAAATAAATCAGGG + Intronic
1065355954 10:24842053-24842075 ATTATTAAAGATATGAATCAAGG + Intergenic
1066265029 10:33768472-33768494 ATATTTAAAGAAATAAAGCAAGG - Intergenic
1066351455 10:34641030-34641052 ATGTTTAAACAAATCTACTAAGG - Intronic
1067263009 10:44711158-44711180 AAGTTAACTCAAATGAATCACGG - Intergenic
1068224441 10:54088766-54088788 TTGTTTCAACAAATGAAGCTGGG - Intronic
1068265397 10:54642038-54642060 ATATTTTAACATATGAATTATGG - Intronic
1068276354 10:54803567-54803589 ATCTTTAGACAAATGAATAGTGG - Intronic
1068390720 10:56392775-56392797 CTGTCTAGAAAAATGAATCATGG + Intergenic
1068679348 10:59802883-59802905 ACGTTTAAATAAATCAAACAGGG + Intronic
1069951111 10:72018768-72018790 AAGTTTCAACACATGAATCTTGG - Intergenic
1070445203 10:76492861-76492883 ATGATTGAAGAATTGAATCATGG - Intronic
1070849479 10:79551947-79551969 AAGTTGGAACAAATGAATGAAGG + Intergenic
1071239420 10:83688045-83688067 GTGCTTAAACAAATGAATCTGGG - Intergenic
1071331959 10:84569648-84569670 ATGTTTAAGCAACTGCATAAAGG - Intergenic
1071409657 10:85376486-85376508 AGATACAAACAAATGAATCAAGG - Intergenic
1071421744 10:85507144-85507166 ATGAATAAATAAATGAATTATGG - Intergenic
1071836141 10:89419313-89419335 ATGTGGAAAAAAATGAATAATGG + Exonic
1071998434 10:91169912-91169934 AAAATTAAACAAATGGATCATGG + Intronic
1072171074 10:92862339-92862361 AGGTTTTAACATATGAATTATGG - Intronic
1072514118 10:96161001-96161023 ACGTTTAAAAAATTAAATCAAGG - Exonic
1072667721 10:97406483-97406505 ATGTATAAATAAATAAATAAAGG - Intronic
1073187123 10:101622082-101622104 ATGTTTTAATCAATGAATCATGG - Intronic
1073211174 10:101804198-101804220 ATATTTAAAAAAAAGAATCATGG + Intronic
1073806727 10:107106724-107106746 AGGTTTAAACATATGAATTTGGG - Intronic
1073876423 10:107927810-107927832 ATGTTTAAAAAAATAAATTATGG + Intergenic
1073978036 10:109122428-109122450 AAGTTTAAGCAACTGAGTCAAGG - Intergenic
1074461391 10:113640951-113640973 ATGATCAAAAAAATGAATGAAGG + Intronic
1074938798 10:118214593-118214615 ATGTGGAAAAAAATGAGTCAGGG - Intergenic
1075168889 10:120094634-120094656 ATGTTTAAAAAAATAAGTGAAGG - Intergenic
1075770009 10:124925787-124925809 GTGTTTCAACAAATGATGCAGGG - Intergenic
1076730131 10:132434299-132434321 AAGTTCTAACAAATGAATCTGGG + Intergenic
1077429731 11:2510291-2510313 ATTTTTAAATAAATAAATAAAGG + Intronic
1077810906 11:5635556-5635578 ATGTTTAAAAAAAAGTAACAGGG - Intronic
1077986330 11:7354981-7355003 TTGTTAAAAAAAATGAATTATGG + Intronic
1078954952 11:16182810-16182832 ATGATTAACAAAATGAAGCAAGG + Intronic
1078959141 11:16243110-16243132 ATGTTTGAAGTGATGAATCAAGG - Intronic
1079339653 11:19601521-19601543 ATGGATAAATAAATGAATAAAGG - Intronic
1079628299 11:22643088-22643110 AAGTTCAAATAAATGAATAATGG + Intronic
1079906587 11:26255725-26255747 ATGTATAAACAAATAAATAATGG - Intergenic
1079938146 11:26643403-26643425 AAGTTTCAACATATGAATCTGGG - Intronic
1080003743 11:27381734-27381756 ATATTTAAACACAGGAATGAGGG - Intronic
1080449192 11:32364638-32364660 AGGATTAAACAAATGAAGTATGG + Intergenic
1080844477 11:36014883-36014905 ATGTTTAAACAAAAGAAGGGGGG + Intronic
1080979881 11:37389251-37389273 GTGTTTAAACAAATTATTGAAGG - Intergenic
1083113462 11:60435397-60435419 ATGTTTTAAGAAATAAATGAGGG + Intronic
1084841714 11:71856941-71856963 ATATTTAAACTTCTGAATCATGG - Intergenic
1085876834 11:80417710-80417732 ATGAAAAAACAAATGAATCCTGG + Intergenic
1086016436 11:82173282-82173304 ATGCTTAAACACATGTCTCAGGG - Intergenic
1086511118 11:87559178-87559200 ATATTTAAATAAATGAATGGTGG + Intergenic
1086790408 11:91030588-91030610 AGGTTTCAACAAATGAATTTGGG - Intergenic
1087070692 11:94077358-94077380 AAATTTAAAGAAATTAATCATGG - Intronic
1087186808 11:95208095-95208117 TTTTTAAAAAAAATGAATCAAGG + Intronic
1087251808 11:95909366-95909388 ATGTCTAAACAAATGAAGTTTGG + Intronic
1087593905 11:100229226-100229248 ATCTTTCAACATATGACTCATGG - Intronic
1087701465 11:101440847-101440869 GTTTTTCAACAAATGAATCTTGG + Intergenic
1087727127 11:101733193-101733215 ATTTTTGAATAAATGAATTAAGG + Intronic
1088346469 11:108832198-108832220 ATTTTTAAAAAAATGACTCTTGG - Intronic
1088371890 11:109099301-109099323 ATGTTTAAAGAAATCAAAAATGG - Intergenic
1090145808 11:124321112-124321134 AAGTTTAAGCAAAGGATTCAGGG + Intergenic
1091000001 11:131902540-131902562 AACTTTAAACCAATGCATCAAGG - Intronic
1091119359 11:133043876-133043898 ATGTATGCACAAATGAATAAAGG - Intronic
1092831641 12:12449681-12449703 TTGTTTGAACAAAGGAAACAGGG + Intronic
1093212546 12:16325201-16325223 ATTTTTACTCAAATAAATCAGGG + Intergenic
1093283476 12:17227044-17227066 TTGTTAAAACACATCAATCATGG - Intergenic
1093814190 12:23523966-23523988 ATATTTTAAAAAATTAATCAAGG - Intergenic
1094482847 12:30898621-30898643 ATCTTTAAAAAAATGTAACATGG + Intergenic
1095274544 12:40265318-40265340 TTGTTTAAAGAAAAGAACCAAGG - Intronic
1095473312 12:42559819-42559841 ATGTTTAATCAATCAAATCAGGG - Intronic
1095572024 12:43694212-43694234 ATTTTGAAACAAATGATTCTGGG + Intergenic
1096611420 12:52804484-52804506 AGTTTCAAACATATGAATCAAGG + Intergenic
1097259323 12:57707025-57707047 AAATTTAGACAAATGAATAATGG - Intronic
1097341133 12:58439427-58439449 ATCTTTAAACAACTAACTCATGG - Intergenic
1097491327 12:60274103-60274125 ATATTTGAACAAATGAAACATGG + Intergenic
1098411994 12:70196122-70196144 AAGTTTCAACACATGAATCTGGG - Intergenic
1098969768 12:76839526-76839548 ATTTTTAAACAAATTTATCTAGG - Intronic
1099276522 12:80583186-80583208 ATGTGTGAGCAAATGAATCGAGG - Intronic
1099943567 12:89218927-89218949 ATGTTTGAACAGATGAAGCATGG - Intergenic
1100359709 12:93864985-93865007 ATGAATAAACAAATGAATGAGGG + Intronic
1100905853 12:99298296-99298318 ATGTGTAGATAATTGAATCATGG + Intronic
1101312085 12:103590235-103590257 TTGATTAAACAAATGAATTGGGG - Intronic
1101412012 12:104477480-104477502 AGGTTTCAACACATGAATTAGGG - Intronic
1101920762 12:108931022-108931044 ATGCTTAAACTAAGGATTCAGGG - Intronic
1101974938 12:109349316-109349338 ATGTTTTACCAAAGGAATCTGGG - Intronic
1104628061 12:130376057-130376079 ATCTTCATACAAATGAGTCATGG - Intergenic
1105978293 13:25492998-25493020 ATGTCTAAACAAATGAATTTTGG - Intronic
1106766192 13:32916197-32916219 ATTTTTAAAAATATGATTCATGG - Intergenic
1107186532 13:37528634-37528656 AGGTTTAAATATTTGAATCAAGG - Intergenic
1107578262 13:41751238-41751260 ATTTTTTAAAAAATGAATTATGG - Intronic
1107607325 13:42072741-42072763 ATTTTTAAACAAAAGAAAAAGGG + Intronic
1107977987 13:45708182-45708204 ATGTTGACATGAATGAATCAGGG - Intronic
1108891159 13:55261549-55261571 CTGTGTAAATAAATGAAGCATGG + Intergenic
1108943947 13:55997769-55997791 ATTTTAAAACAAATTAATCATGG - Intergenic
1109254240 13:60059470-60059492 ATGTTTAAAAACCTGAATTAAGG - Intronic
1109427242 13:62180944-62180966 ATGTAAAAATAAATGAATAAGGG + Intergenic
1109471323 13:62808703-62808725 ATATTTACAGAAATAAATCAAGG + Intergenic
1109885601 13:68539372-68539394 ATCTTTAAACAAACCAATTATGG + Intergenic
1110080308 13:71301793-71301815 ATGTTAAAACATATGAAATATGG - Intergenic
1110234934 13:73207125-73207147 TGGTTTTAACAAATGTATCATGG + Intergenic
1111238752 13:85446154-85446176 ATTCAGAAACAAATGAATCATGG + Intergenic
1111433124 13:88170077-88170099 ATATATAAACAAAAGAAACAGGG - Intergenic
1111786783 13:92797106-92797128 ATTTTAAAAGTAATGAATCAAGG - Intronic
1112539798 13:100297811-100297833 CTGTTTGAACAAAAGATTCATGG + Intronic
1112634065 13:101195507-101195529 ATGTTTAAAATAATAAAGCAAGG - Intronic
1112742742 13:102493838-102493860 ATGTTTCAACATATGAATTTTGG - Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1113024869 13:105929394-105929416 AAGGTTAAACAAAAGCATCAGGG + Intergenic
1114264589 14:21065794-21065816 ATGTTTAAAGAACTGAAAGAAGG + Intronic
1114334601 14:21675278-21675300 CTGTTAAAACAAATGAAATATGG + Intergenic
1114997028 14:28366116-28366138 AGGTTTAAATAAAGGAATTAGGG + Intergenic
1115106641 14:29769904-29769926 AGGTTTCAACATATGAATTATGG - Intronic
1115679711 14:35722970-35722992 TTGTTTAAATAATTGAGTCAGGG - Intronic
1115847986 14:37558519-37558541 ATTTTTAAAAAAATGAATGAAGG - Intergenic
1115929998 14:38480733-38480755 ATTATTAAATAAATGTATCAAGG - Intergenic
1116179197 14:41514281-41514303 AGGTGGAAACAAATGAGTCATGG + Intergenic
1116254425 14:42532854-42532876 ATATTTTTACAAAAGAATCAAGG + Intergenic
1116298658 14:43146880-43146902 ATGTTTAAAGGAATGAATGATGG - Intergenic
1116566660 14:46453595-46453617 ATATTTAAACAAGTTATTCATGG - Intergenic
1116793379 14:49363753-49363775 ATTTTAAAACAATTGACTCAGGG - Intergenic
1116986043 14:51221682-51221704 ATGTTTGAACAAATATATCTGGG + Intergenic
1117442527 14:55773481-55773503 ATGTGTATCCAAATGCATCAGGG - Intergenic
1117525290 14:56595897-56595919 ATATTTAAACACTTGAATTAAGG + Intronic
1120155644 14:81090091-81090113 ATGTTAAAACAACTAAATCTGGG + Intronic
1120312930 14:82854436-82854458 ATGAATAAAGAAATAAATCATGG - Intergenic
1120493721 14:85207679-85207701 AGGTTTCAACATAAGAATCAGGG + Intergenic
1120593263 14:86401823-86401845 ATTTTTAAATAAATGAATATTGG + Intergenic
1120628493 14:86859098-86859120 AAATTCAAACAAATGGATCATGG - Intergenic
1120824572 14:88943819-88943841 AGGTTTCAACATATGAATCTTGG + Intergenic
1120929400 14:89833681-89833703 ATGTTTAATCAAATTTATCCAGG + Intronic
1121906312 14:97749602-97749624 ATGTTCAAACCCATGAGTCAGGG + Exonic
1122026220 14:98879329-98879351 ATATATAAACAAATCCATCATGG - Intergenic
1122188888 14:100024148-100024170 ATTTTTAAACAAAAACATCATGG + Intronic
1124986839 15:34626390-34626412 TTTTTTTGACAAATGAATCAGGG + Intergenic
1125069710 15:35538812-35538834 ATGTTTTTACAAATCATTCAAGG + Intronic
1125107810 15:35994441-35994463 ATGTTCAGAAAAATAAATCAAGG - Intergenic
1125166829 15:36715971-36715993 TTGTTAAAACCAATGAATGATGG - Intronic
1125502679 15:40249265-40249287 AGGTTTCAACAGATGAATCTTGG + Intronic
1125502684 15:40249295-40249317 AGGTTTCAACAGATGAATCTTGG + Intronic
1125653244 15:41334420-41334442 TTGTTTAAACAAAATAATCAGGG + Intronic
1126127062 15:45304599-45304621 TTTTTTAAAGTAATGAATCAAGG - Intergenic
1126553850 15:49964801-49964823 ACATTTCAACAAATGAATCCTGG + Intronic
1126981921 15:54254504-54254526 GTGGTTAAACTAATGAATGAAGG + Intronic
1126985883 15:54307436-54307458 ATGTTGAAACCTATGACTCAAGG - Intronic
1127326651 15:57902195-57902217 CTTTTTAAAAAAATGAATCCAGG - Intergenic
1127371141 15:58342795-58342817 ATGTTTAAAAGAATGAACCCTGG + Intronic
1127466444 15:59249110-59249132 ATTTTGAAAGAAATAAATCAAGG - Intronic
1127992475 15:64130922-64130944 ATTTTTAAAGGAATGAATGAGGG + Intronic
1128395104 15:67216907-67216929 AACTGTAAGCAAATGAATCATGG - Intronic
1128502397 15:68236043-68236065 ATGTTTAAATAAATAAAACATGG + Intronic
1129913989 15:79252046-79252068 AAGTTTAAAAAAATTAAACAAGG - Intergenic
1130363676 15:83213296-83213318 GAGTTTCAACAAATGAATCGGGG - Intergenic
1131571086 15:93536976-93536998 ATGATTAAACAAATAAATAAAGG - Intergenic
1131699127 15:94914618-94914640 ATGATTAAATAAAAGAATCATGG - Intergenic
1131792357 15:95978969-95978991 ATGAATAAAGAAATGAATAAAGG - Intergenic
1131884349 15:96894881-96894903 ATGTTTAAACAAAGCAGTAAAGG - Intergenic
1132371408 15:101301961-101301983 AGTTTAAAACAAATGCATCATGG + Intronic
1132425499 15:101712825-101712847 CTGTTTGATAAAATGAATCAGGG + Intronic
1132459853 16:46809-46831 AGGTTCAAAAAAATGAATAAGGG + Exonic
1133053584 16:3133328-3133350 ATGTTCAAGCAAATGAATAAAGG + Intronic
1133078572 16:3299617-3299639 TTGATTCAACCAATGAATCAAGG - Exonic
1133563022 16:6967216-6967238 ATGTATAAACAAATGGATGATGG - Intronic
1133608732 16:7413367-7413389 AGGTTTTAACAAGTGATTCAGGG - Intronic
1133703949 16:8335517-8335539 ATGTTTAAATTTATGTATCAAGG + Intergenic
1133772154 16:8873220-8873242 TTGTTTGAACAAATGTATAATGG + Intergenic
1134315366 16:13113926-13113948 ATGAATGAACAAATGAATAATGG - Intronic
1134741806 16:16554288-16554310 ATATTTAAACAAATAAAAGATGG - Intergenic
1134802795 16:17100898-17100920 AGGTTTTGACAAATGAATCTTGG + Intergenic
1134894321 16:17871152-17871174 AGGTTTCAACATATGAATCTAGG + Intergenic
1135151876 16:20014693-20014715 ATGTTTAAATAAATGTATCATGG + Intergenic
1135309856 16:21396902-21396924 AAGTTTTAACATATGAATCTTGG + Intergenic
1135362749 16:21829002-21829024 AAGTTTTAACATATGAATCTTGG + Intergenic
1135420221 16:22300833-22300855 TTGTCTAAATAAATGAACCATGG - Intronic
1135636895 16:24085332-24085354 ATTTTCATACAAATGAATCTTGG - Intronic
1136149437 16:28337224-28337246 AAGTTTTAACATATGAATCTTGG + Intergenic
1136306601 16:29376026-29376048 AAGTTTTAACATATGAATCTTGG + Intergenic
1136528995 16:30854143-30854165 TTGTTTCAACCAATGGATCATGG - Intronic
1137782831 16:51112375-51112397 ATGGTTAAAAAAATAAAACAAGG - Intergenic
1138035313 16:53599246-53599268 ATGTTTAATCAAATAAAGAAAGG - Intronic
1139177588 16:64708388-64708410 AAGTTTCAACAAATGAATCCAGG - Intergenic
1139386611 16:66576685-66576707 ATATTAAAACAAATGAGTTATGG + Intronic
1140574450 16:76149427-76149449 GTTTTTAAACAAATGAATCAAGG - Intergenic
1141260534 16:82449520-82449542 TTGAATAAACAAATGAATGAAGG + Intergenic
1143054498 17:4152712-4152734 ATGAATAAAGAAAGGAATCAGGG - Intronic
1143239346 17:5430730-5430752 ATGTTTGTACAAATGAGTTAAGG + Intronic
1144280459 17:13721231-13721253 ATGTTTAAATGAAGGATTCAAGG + Intergenic
1144393701 17:14821609-14821631 ATATTTAAGCAAAATAATCAAGG - Intergenic
1146086217 17:29832442-29832464 ATGTTTGAATAAATGAATGATGG + Intronic
1146191202 17:30767967-30767989 ATGTTCAAAAAAATGTATCGGGG + Intergenic
1146336360 17:31974613-31974635 ATGTTCAAAAAAATGTATCGGGG + Intronic
1149217307 17:54372464-54372486 ATACTTAAACAAAGGAATAAGGG - Intergenic
1151872849 17:76848332-76848354 TTGTTTAAAAAAAAAAATCAAGG - Intergenic
1153249832 18:3110249-3110271 ATGTTTAAAAAACTGAAGCATGG + Intronic
1153465440 18:5382781-5382803 ATGTGCAAAAGAATGAATCATGG - Intergenic
1153534075 18:6081824-6081846 ATGTTTACACAAGTATATCATGG + Intronic
1153610148 18:6876647-6876669 ATGTTTAAACCAACGAATGATGG - Intronic
1153714153 18:7828881-7828903 ACGTTTACACAAATGAATGATGG + Intronic
1154063034 18:11081474-11081496 ATGTTTAAAAAAATTATACATGG - Intronic
1155456139 18:26016373-26016395 AAGTTTGAACAGATAAATCATGG - Exonic
1156071994 18:33222640-33222662 ATGTTTCAACATATGAATTTTGG + Intronic
1156600098 18:38595646-38595668 ATGTTTAAACAGATGTGTTAAGG + Intergenic
1156794404 18:41025243-41025265 ATGTTTAATGAAATTATTCATGG + Intergenic
1157832447 18:50869115-50869137 AAATTTATAAAAATGAATCATGG + Intergenic
1157839657 18:50944823-50944845 ATTTATAAATAAATGAATGAAGG - Intronic
1158028344 18:52930713-52930735 ATGTTTCAATAAATGTATGAAGG - Intronic
1158144210 18:54292415-54292437 ATACTTTAACAAAAGAATCATGG - Intronic
1158714240 18:59863594-59863616 CGGTTTGAACAAATGTATCATGG - Intergenic
1158918664 18:62164800-62164822 GTGGGTAAAGAAATGAATCAAGG + Intronic
1159518270 18:69486196-69486218 ATGTTTAAAGATATCAATAAAGG - Intronic
1159575920 18:70177314-70177336 ATTTCTAAAGAAATGCATCAAGG + Intronic
1159681186 18:71354564-71354586 ATGTTTAAATAAATACATGAAGG + Intergenic
1162616531 19:11805505-11805527 ATGTTTAAACAATTCAGACAGGG + Intronic
1163999882 19:21088677-21088699 ATTTTTAAACCAATTAATCAGGG + Intronic
1165652620 19:37504704-37504726 ATATTAAATCAAATGAAGCAAGG + Intergenic
1166211183 19:41307554-41307576 ATGTTAAAACATATGAGTCAAGG - Intronic
925985210 2:9209528-9209550 ATGTTTAAACAAATGAATCACGG + Intronic
926422369 2:12712673-12712695 ATGTTTCAACATGTGAATCTGGG - Intergenic
926727791 2:16012159-16012181 ATGGTTTAACAAAGGCATCATGG + Intergenic
926738465 2:16091935-16091957 ATGATTAAATAAAGGAATGATGG + Intergenic
927068086 2:19493830-19493852 ATGTTTAAAGAACTGAAGGAAGG + Intergenic
927315961 2:21682875-21682897 ATCTTTAAACAAATGGTTCTAGG + Intergenic
927462472 2:23310869-23310891 ATGACTGAACAAATGAATAAGGG + Intergenic
927529789 2:23785231-23785253 TTTTTTAAAAAAATGAATTATGG - Intronic
927737795 2:25537591-25537613 TTGTCTAAACACATGAATAAGGG + Intronic
928998966 2:37326233-37326255 ATTTTTAAATAAAGTAATCAAGG - Intergenic
929416700 2:41749360-41749382 CTGTGGAAACAAATGATTCAGGG - Intergenic
929477547 2:42267019-42267041 ATGTTTAAACACATGGATTTTGG + Intronic
930821156 2:55648892-55648914 ATTTTTAAACAAATGAAAGATGG - Intronic
931023566 2:58079779-58079801 ATTTTCAATGAAATGAATCAGGG - Intronic
931095434 2:58934967-58934989 CTGAATAATCAAATGAATCAAGG + Intergenic
931314845 2:61119241-61119263 ATTTTTAAATAAAAGAATTAGGG - Intronic
931856049 2:66302727-66302749 ATGAGTAAACAGATGAATAAAGG - Intergenic
932079906 2:68704451-68704473 ATATTTAAAAAAAAGAAACAAGG + Intronic
932095720 2:68846674-68846696 ATCTTTAACCAAATGGAGCACGG + Intergenic
933016398 2:77132783-77132805 AAGTTTTAACACATGAATTATGG + Intronic
933091200 2:78119519-78119541 TTTTTTAAACAACAGAATCATGG - Intergenic
933866858 2:86527414-86527436 ATGTTTAAACAAGCTTATCATGG + Intronic
933885454 2:86715838-86715860 CTGTTAATAAAAATGAATCAGGG - Intronic
933994771 2:87660215-87660237 ATGTTTTAAAAAAGGAATAACGG - Intergenic
934668770 2:96193990-96194012 ATGGTTTAAAAAATGAAACAGGG - Intronic
934948783 2:98562126-98562148 AGGTCTTAGCAAATGAATCATGG - Intronic
935460272 2:103323122-103323144 ATCTTTCAACTCATGAATCAAGG + Intergenic
936299084 2:111290698-111290720 ATGTTTTAAAAAAAGAATAACGG + Intergenic
936511523 2:113151376-113151398 ATGATTAAAAAAATGAACCCTGG - Intergenic
936620021 2:114086060-114086082 ATTTTTAAAGAAATAAAGCATGG - Intergenic
937187468 2:120058185-120058207 ATTTTTAAATAAAAGAAGCAGGG + Intronic
937426420 2:121802996-121803018 ATGCTTAAATAAAGGAATTAAGG - Intergenic
938904776 2:135827345-135827367 AGGTTTAAACAATTTAACCAAGG - Intronic
940260594 2:151775927-151775949 ATGTTTCAACATATGAATTTGGG - Intergenic
940350037 2:152674174-152674196 ATGTGTAAACAAATGAACGCGGG - Intronic
940619355 2:156091588-156091610 ATGATTACAAAGATGAATCATGG - Intergenic
940620090 2:156101418-156101440 TTGGTTAAATAAATGAATGATGG - Intergenic
941169625 2:162120771-162120793 ATGTGTACACACATGCATCAGGG + Intergenic
941763585 2:169271675-169271697 ATTTTTAAACAAAAGATTGATGG - Intronic
941789276 2:169533830-169533852 ATGTTTCAACAGATGAATTTTGG - Intronic
941794912 2:169588290-169588312 ATAATTAAACCATTGAATCATGG + Intronic
941883983 2:170509607-170509629 TTATATACACAAATGAATCAAGG - Intronic
942012673 2:171778503-171778525 ATTATTAAACAAATGACTGACGG + Intergenic
942228483 2:173837507-173837529 ATGTTTAAAGAACTGAAAGAAGG - Intergenic
942395426 2:175542530-175542552 ATGGTAAAACAAATTCATCAAGG - Intergenic
942779573 2:179625518-179625540 ATATATAAACAGATGAATAAAGG + Intronic
943331074 2:186559887-186559909 ATATGTAAACACATGAATGAAGG + Intergenic
943377056 2:187090727-187090749 ATGATTAAAAGAATGAATCGTGG + Intergenic
943389053 2:187239611-187239633 ATTTTTCCACAAATGAATCCTGG + Intergenic
943746333 2:191466006-191466028 ATCTTTAAACAAAAGAATACGGG + Intergenic
944335797 2:198532676-198532698 ATGATTAAATAAATAATTCAAGG + Intronic
945664649 2:212725592-212725614 AAGTTTCAACATATGAATCTGGG + Intergenic
945747816 2:213740269-213740291 AGGTTTAAACAGATGACTCCAGG + Intronic
946502520 2:220264638-220264660 ATGTTTAAACTATTGCATTATGG - Intergenic
946503074 2:220270404-220270426 ATTTTTAAAGAGATTAATCATGG - Intergenic
946755543 2:222942568-222942590 ATTTGTAAACAAATTAGTCATGG + Exonic
947300389 2:228682673-228682695 TTAATTAAACAAATAAATCAAGG - Intergenic
947558808 2:231126612-231126634 ATCTATAAACAAATCAATAAAGG - Intronic
1169415755 20:5414879-5414901 ATATTTAGACAAATGGTTCAAGG - Intergenic
1169556183 20:6752731-6752753 ATATTTAAACAGGAGAATCAAGG - Intergenic
1169941892 20:10946522-10946544 TTTTTTAAACAAATCAATCCAGG + Intergenic
1170031255 20:11946600-11946622 TTATTTAAATAAATGAATCATGG - Intergenic
1170192373 20:13657057-13657079 ATGTTCAATCGAATGAATAAAGG - Intergenic
1170253137 20:14308620-14308642 ATGTTTTAACAAATCAATTGTGG + Intronic
1170308518 20:14966974-14966996 TTGTTTAAACAAATAATTTATGG + Intronic
1170410633 20:16087179-16087201 TTGTTTTAACAAATGATTAAAGG + Intergenic
1171238289 20:23545585-23545607 ATCTTTATATAAATGACTCAGGG + Intergenic
1172057687 20:32165766-32165788 TTGTTTTAACAAATGGATCCAGG + Exonic
1172329958 20:34068608-34068630 ATGTTTAAACATATGGTACATGG - Intronic
1172582573 20:36059993-36060015 ATGATTAAATAAATAAATGAGGG + Intergenic
1172712579 20:36937781-36937803 ATTTTCAAACTACTGAATCACGG - Intronic
1173017802 20:39242252-39242274 AAATTTAAAAAAATGGATCATGG + Intergenic
1173673510 20:44814138-44814160 ATGCTTAAGAAAATGAATGAGGG + Intergenic
1173951056 20:46993532-46993554 ATGAATGAACAAATGAATGAAGG - Intronic
1174929792 20:54800601-54800623 ATGTTAAAACAAGTGATACAGGG + Intergenic
1175357775 20:58382538-58382560 ATGTTTAAAGAAATAAAAAAGGG + Intergenic
1176073093 20:63236820-63236842 ATGTTTAAAGAACAGGATCAGGG + Intronic
1176427533 21:6558006-6558028 ATGTTTAAACAAATCAAAATGGG + Intergenic
1176929565 21:14791984-14792006 ATGTTTCAACATATGAATTCTGG - Intergenic
1177577675 21:22979612-22979634 ATTTTTAAACAAGTTAAACAAGG + Intergenic
1177734526 21:25072603-25072625 AGGTTTCAACATATGAATCTGGG + Intergenic
1177749012 21:25256754-25256776 AGGTTTCAACAAATGAATTTGGG + Intergenic
1177783291 21:25642307-25642329 ATGATTAAATAAATAAATGAAGG - Intronic
1177787403 21:25685989-25686011 ATTTTTTAAAAAATGTATCAAGG + Intronic
1177926997 21:27229760-27229782 ATGTTAAAATAAAAGAAACAAGG + Intergenic
1178165014 21:29963967-29963989 ATGTTTCAACAAATGAATTTGGG - Intergenic
1179703024 21:43166323-43166345 ATGTTTAAACAAATCAAAATGGG + Intergenic
1179805324 21:43833623-43833645 AAGCTTAAACATATGAAACATGG + Intergenic
1182140101 22:27947179-27947201 ATATTTGAAGAAATGAATAATGG - Intergenic
1184995264 22:48200918-48200940 ATGTTTATACAAAGGAAAGAAGG + Intergenic
949459842 3:4279316-4279338 ATGTAGAAACAAAACAATCAAGG + Intronic
949484384 3:4523730-4523752 ATGTTGTCACAAATGAACCAGGG + Intronic
949910306 3:8899249-8899271 ATTTTTAAACTAATTAATCTTGG - Intronic
949996918 3:9625314-9625336 ATGGGTAAACAAACAAATCATGG - Intergenic
950879027 3:16306612-16306634 TTTCTTTAACAAATGAATCATGG - Intronic
951105280 3:18734963-18734985 ATGTTGAAATAAATAAATAAGGG - Intergenic
951117011 3:18875736-18875758 ATGTTTAAACAAAAGAACCAGGG - Intergenic
951367202 3:21797933-21797955 ATATTTAGACAAATGTATAATGG - Intronic
951371776 3:21858402-21858424 AGGTTTAAACATGTGAATCTGGG - Intronic
951527462 3:23667753-23667775 AGGTTTAAACACATGAATTTTGG - Intergenic
951712606 3:25600343-25600365 ATATTTGATCAAATGAATCAGGG + Intronic
951946140 3:28138609-28138631 ATGTATAAACAAATGAGAAAGGG + Intergenic
952317948 3:32248141-32248163 ATGTTTTAATATCTGAATCAGGG + Intronic
952469670 3:33633616-33633638 ATGTTTAAAGAAATCAAGGATGG + Intronic
952778162 3:37066560-37066582 ATGTTTAATCACATCAAGCAGGG + Intronic
952910046 3:38176233-38176255 ATGGTTAAACAACTGTATTAAGG + Intronic
952983899 3:38760555-38760577 ATGTATAAATAAATAAATCATGG - Intronic
954472464 3:50709517-50709539 CTGTTTAAAAAAAAAAATCATGG - Intronic
954588579 3:51759771-51759793 AAGTTTAAACAAAAGAATTTAGG - Intergenic
955040134 3:55308377-55308399 AGGTTTTCACAAATGAATTAGGG + Intergenic
955200284 3:56845821-56845843 ATGAATAAAGAAATGAATAAAGG + Intronic
955804988 3:62724412-62724434 GTTTAAAAACAAATGAATCAAGG + Intronic
955847469 3:63181153-63181175 ATATTAAAACACGTGAATCAAGG + Intergenic
956993079 3:74791452-74791474 ATATTTCAACATATGAATCTGGG + Intergenic
957165601 3:76669081-76669103 ATGTTTAAACATATGAAAACAGG + Intronic
957661811 3:83165893-83165915 ATGTACAAACATATGAATAATGG - Intergenic
957669145 3:83278287-83278309 AAGTTTCAACATATGAATCTGGG - Intergenic
957693666 3:83604346-83604368 ATTTTTAAAAAAATGGATAAGGG - Intergenic
957798126 3:85038662-85038684 ATGTTTAAATAACTAAATCTAGG - Intronic
958047293 3:88301696-88301718 GTGAATAAATAAATGAATCAAGG - Intergenic
958846396 3:99269999-99270021 GTGTCTGAAGAAATGAATCAGGG - Intergenic
959109623 3:102106237-102106259 ACATTTAAATAAATGAATAAGGG - Intronic
959770873 3:110094169-110094191 AGGTTTGAACAAATGTATAATGG + Intergenic
959857502 3:111176257-111176279 ATGATTAATAAAATGAGTCAAGG - Intronic
959917227 3:111829389-111829411 TTTTTTAAACAAAAGAATAATGG - Intronic
960207521 3:114920581-114920603 ATCTTTAAACAAATGAAAATGGG + Intronic
962243474 3:133771336-133771358 CTGATTAAACAAATGAAGAAGGG + Intronic
962558970 3:136586122-136586144 ATGTTTAAATATATGAAATATGG - Intronic
962947988 3:140189785-140189807 ACTTTTAAACAAATGGATGAGGG - Intronic
963088267 3:141458476-141458498 ATTGTTAAACAAATGAAATAAGG - Intergenic
963412946 3:144955009-144955031 ATTTTTAAAAAAATGATGCATGG + Intergenic
963961163 3:151310698-151310720 AAATTTAAACAAATGAAGCCTGG - Intronic
964079219 3:152730870-152730892 ATATTTATATTAATGAATCAAGG + Intergenic
964081250 3:152760781-152760803 AAGCTAAAACTAATGAATCACGG + Intergenic
964198366 3:154089757-154089779 TGGTTTAAAAAAATGAAGCATGG + Intergenic
964284655 3:155104639-155104661 ATGTTTAAACAGAAGGAACATGG + Intronic
965324208 3:167281809-167281831 ATGTTTATACAGATCATTCAGGG - Intronic
965366349 3:167805109-167805131 TTTTTTAAACAAAAGAATCATGG - Intronic
965457025 3:168914178-168914200 TTTTTTAAACAAATAAATAAAGG + Intergenic
965559244 3:170045875-170045897 AGGTTTTAAAAAATGAGTCAAGG - Intronic
965976506 3:174630519-174630541 ATGTTCAAACATTTGCATCATGG + Intronic
965983238 3:174719102-174719124 ATGTTAGAGCAAATGAAGCATGG - Intronic
966271283 3:178109679-178109701 GAGTTTACACAAAGGAATCAGGG - Intergenic
966483104 3:180433624-180433646 ATGTTTAAACAAAATAATTCAGG - Intergenic
967019953 3:185514089-185514111 ATGTTTAATCAAAGGAAGTAAGG + Intronic
967190323 3:186979126-186979148 TTGTGTGAACAAATGAATGAGGG + Intronic
967332890 3:188309487-188309509 ACGTTTAAACAGAGAAATCAGGG - Intronic
967809043 3:193740319-193740341 ATGTTAAAAAAAATGATTCTAGG - Intergenic
968247790 3:197171468-197171490 ATTTTTAAACAAATCACTAAGGG + Intronic
968389611 4:178714-178736 ATTTTTAATAAAATGAACCAAGG - Intergenic
969085888 4:4656113-4656135 AAGTTTCAACATATGAATCTGGG - Intergenic
969782815 4:9422974-9422996 ATATTTAAACTTCTGAATCATGG - Intergenic
969921242 4:10541821-10541843 ATGATTAAATAGATGAATGAAGG + Intronic
969931623 4:10636560-10636582 ACATATAAGCAAATGAATCATGG + Intronic
970714955 4:18910999-18911021 ATGTTTAAATAAATAAATTCAGG + Intergenic
970790043 4:19846562-19846584 TTGTTTAAAGAAATGTATCTAGG + Intergenic
970802960 4:19996779-19996801 ATGTTGAAATAAATGTATTATGG + Intergenic
970892116 4:21058841-21058863 ATTTTTAATCAGAAGAATCAGGG - Intronic
971221826 4:24715939-24715961 AAAATTAAAAAAATGAATCAAGG - Intergenic
971364290 4:25965139-25965161 ATCTTTGAAGAAATGAATAAGGG - Intergenic
971464841 4:26946142-26946164 ATCTTTATACAACTGAAACATGG - Intronic
971567016 4:28157802-28157824 AAGATTAAATAAATGAATGAAGG + Intergenic
971599597 4:28575457-28575479 ATGTTTCAACATATGAATTTGGG + Intergenic
971771632 4:30904755-30904777 AAGTTAAAACAAATGAGTGATGG + Intronic
971913651 4:32830323-32830345 ATGTTTATACAACTGAATGGAGG - Intergenic
972012614 4:34203800-34203822 ATGGTTAAACAAATGAATAAGGG - Intergenic
972181354 4:36470666-36470688 AAGTTTTAACAAATGAATTTAGG - Intergenic
972841897 4:42940604-42940626 ATATTGCAATAAATGAATCAAGG + Intronic
972877708 4:43384797-43384819 ATTTTTAGACTAAAGAATCATGG + Intergenic
972938103 4:44164827-44164849 ATGTATTAATAAATGAATCTAGG - Intergenic
972996583 4:44886364-44886386 CTGTTTATTCAAATGTATCAAGG - Intergenic
973024255 4:45247845-45247867 ATGTTTCAACACATGAATTTTGG - Intergenic
973206353 4:47564705-47564727 ATGTTTAATCAGATAAATAAGGG + Intronic
973928025 4:55759627-55759649 ATGTTAAAACAAATTGTTCAAGG - Intergenic
974412593 4:61561493-61561515 TTTTTAAAACAAATGATTCAGGG + Intronic
974441840 4:61929089-61929111 AAGTTTCAACACATGAATTATGG - Intronic
974770887 4:66411859-66411881 AATTTTTGACAAATGAATCAAGG + Intergenic
975247091 4:72131806-72131828 AGGTTTAAACAAATGATGGAAGG + Intronic
975942600 4:79665085-79665107 ATTTTTAAACAAAAGAATTTTGG + Intergenic
977104991 4:92871061-92871083 ATGTTTTAAAAAATGAAAAAGGG - Intronic
977401567 4:96539190-96539212 ATGTTTCAACATATGAATTTTGG - Intergenic
977464718 4:97369494-97369516 AAGTTTAAACATATGAATTTGGG - Intronic
977653833 4:99499088-99499110 ATCTTTAAACACCAGAATCAAGG + Intergenic
978217453 4:106222083-106222105 TTATTTAAACAAATAAATTAAGG + Intronic
978647206 4:110949817-110949839 ATCTTCAAATAAATGAACCAAGG - Intergenic
979506193 4:121500580-121500602 ATGTTTAAAGATATGAATTGAGG + Intergenic
979560623 4:122097521-122097543 ATGTTTACAAAATTGAAACAGGG - Intergenic
980627872 4:135397662-135397684 ATCTTTAAAAAAATGTATCCTGG - Intergenic
980782982 4:137515567-137515589 CTCATTAAACCAATGAATCATGG + Intergenic
980829648 4:138114389-138114411 ATGTTTTATTTAATGAATCAAGG - Intergenic
981008891 4:139904091-139904113 ATGTTTCAACACATGAATTCTGG + Intronic
981132768 4:141176316-141176338 ATGTTTCAACATATAAATCATGG + Intronic
981665226 4:147216966-147216988 ATATTTAAACATATGTTTCAAGG - Intergenic
981805104 4:148706226-148706248 ATGTTTTAAAAAATGTCTCATGG - Intergenic
981869285 4:149467342-149467364 ACGAATAAACAAATGAATTAAGG - Intergenic
982626321 4:157771032-157771054 ATTTTTAAAAAAATGAAACATGG + Intergenic
982921609 4:161280720-161280742 AAGTTTAAAAAAATTAATAACGG - Intergenic
983366391 4:166795883-166795905 ATGTTATAACATATGAATCTGGG - Intronic
983645699 4:169989351-169989373 ATCTATAAACAAACTAATCAAGG + Exonic
983823214 4:172223616-172223638 AAGTTTGAATAAATGAATAATGG + Intronic
984196863 4:176667470-176667492 AGCTTAAAACAAATGAATCAAGG + Intergenic
984375781 4:178927070-178927092 AAGTTTCAAGATATGAATCATGG - Intergenic
985051112 4:185992669-185992691 TTTTTTAAAAAAATGAATCAAGG - Intergenic
985121577 4:186648494-186648516 ATTTTTAATGAAATGGATCACGG + Intronic
986527249 5:8693299-8693321 AATTTTAAACTATTGAATCATGG + Intergenic
987098652 5:14573049-14573071 AAGTTTCAACATATGAATTACGG + Intergenic
987214436 5:15718741-15718763 ATGTTTAAAGAAAAGAAAAAAGG - Intronic
987886006 5:23813543-23813565 ATGTTTAAATAATAGTATCAGGG - Intergenic
988412673 5:30907351-30907373 AAGTTTCAACATATGAATCTTGG + Intergenic
989008500 5:36842678-36842700 ATTTTTAAACAAATTAATATTGG - Intergenic
989399620 5:40994744-40994766 AGGTTTCAACAAATGAATTAGGG - Intergenic
990425957 5:55689167-55689189 ATGTTCTAGCAAATGAACCAGGG + Intronic
990827024 5:59911833-59911855 ATGTTTAAAGTAATGTATTATGG + Intronic
991132109 5:63134296-63134318 TTGTTTTGACAAATGTATCATGG + Intergenic
991241045 5:64460030-64460052 ATGTTGAACCAAATGAATACTGG + Intergenic
991357535 5:65784661-65784683 ATGTTTCAACACATGAATTTTGG + Intronic
991393835 5:66182280-66182302 ATATTTAAACACAAGAAACATGG - Exonic
991409090 5:66329230-66329252 TCATCTAAACAAATGAATCATGG + Intergenic
993118640 5:83747305-83747327 GTGTTAAAAAAAATAAATCATGG - Intergenic
993334087 5:86635166-86635188 ATGTTTCAACATATGAATTTGGG + Intergenic
993981879 5:94552694-94552716 TTCTTGAAACAAATGAAACATGG + Intronic
994049032 5:95341917-95341939 ATCTTTAAAAAAATAGATCAAGG - Intergenic
994114245 5:96044218-96044240 AGGTTTCAACACATGAATTAAGG - Intergenic
994362884 5:98874997-98875019 ATGTTAATACAAATAAATAAAGG + Intronic
994759533 5:103835629-103835651 AAGTTTCAACAAATGAATTTGGG - Intergenic
994798294 5:104335164-104335186 GTGTTTAAAAAAAGGAATAAGGG + Intergenic
995002682 5:107153817-107153839 GTGTGCAAACAAAGGAATCATGG - Intergenic
995091048 5:108177749-108177771 ATTTTCAAACAAAGGAATTAAGG - Intronic
995680014 5:114705326-114705348 ATGTTTTAATAAATGGATGAAGG - Intergenic
995764458 5:115600969-115600991 ATGTTTACACTGTTGAATCATGG - Intronic
995822818 5:116256514-116256536 ATGTTTAAAGAAATCAAGGATGG + Intronic
996442147 5:123503660-123503682 CTGTTTAGACAAAGGAATAAAGG - Intergenic
996632756 5:125655606-125655628 TTGTTTAAATAATGGAATCATGG + Intergenic
997065127 5:130550281-130550303 ATGATTAAAAAAGAGAATCAAGG + Intergenic
997890146 5:137668847-137668869 ATGAATCAACAGATGAATCAGGG + Intronic
998571834 5:143267043-143267065 ATGTTTAGACAAATGTATGATGG + Intergenic
1000389313 5:160706599-160706621 ATTTTTAAACAAACTAACCAGGG - Intronic
1000882322 5:166712616-166712638 ATTTTTAAACAGATAAACCAGGG - Intergenic
1000901958 5:166921903-166921925 ATGAATGAACAAATGAATGAAGG + Intergenic
1000979818 5:167804728-167804750 ATCTCTAAACAAATGAATCACGG + Intronic
1001078353 5:168647069-168647091 TTGATTGAACCAATGAATCAAGG + Intergenic
1001188104 5:169597307-169597329 ATTTTTTAACAAATGACTCTGGG - Intronic
1001864069 5:175087787-175087809 ATGTCTAAATAAATGAAGAAAGG - Intergenic
1001876684 5:175207714-175207736 ATGTTTAAATATATGACTGAGGG + Intergenic
1002008651 5:176258181-176258203 AGGGTTAAACATATCAATCATGG + Intronic
1002218070 5:177654070-177654092 AGGGTTAAACATATCAATCATGG - Intergenic
1004108168 6:12685880-12685902 ACTTATAAAGAAATGAATCAAGG + Intergenic
1004410775 6:15379617-15379639 AAGTTTAAGGAAATGAATCCAGG - Intronic
1004612784 6:17261101-17261123 AAGTTTAAGCAAATATATCATGG + Intergenic
1005358272 6:25006236-25006258 ATGAATAAACGAATGAATGAAGG - Intronic
1005478858 6:26235609-26235631 ATGTTTAAACCACTGAAATATGG - Intergenic
1005607959 6:27494380-27494402 CAGGTAAAACAAATGAATCAGGG - Intergenic
1007542067 6:42655888-42655910 ATTTTTATAAAAATGTATCAGGG - Intronic
1007950785 6:45870309-45870331 ATGTTTGCACAAATATATCAGGG + Intergenic
1008013978 6:46497120-46497142 ATTTTTAAACAAAAAATTCATGG + Intergenic
1008081676 6:47201790-47201812 ATTTTTAAAAAACTGAATAATGG + Intergenic
1008292473 6:49734128-49734150 ATGTGTAAATAAATGAATCCAGG - Intronic
1008788721 6:55202747-55202769 AGGTTTCAACAAATGAAGCCGGG + Intronic
1009765408 6:68067848-68067870 ATGTTAAAACAAATGACTTTTGG - Intergenic
1010029344 6:71256990-71257012 ATGTCTATAAAAATGAAACATGG - Intergenic
1010308104 6:74348823-74348845 TTGTTTAAACATACGAATAATGG + Intergenic
1010515057 6:76762414-76762436 ATGTAGAGACAATTGAATCATGG - Intergenic
1010926086 6:81748238-81748260 ATGTTTAATCTAGTGGATCATGG - Exonic
1011048742 6:83118279-83118301 ACGTTTAAAAAAATGATTAAAGG - Intronic
1011063925 6:83303018-83303040 ATGGTTATAGAAATGGATCAAGG + Intronic
1011279277 6:85660799-85660821 ATGTTTAAAGAAATAAAGGAAGG - Intergenic
1011728582 6:90236155-90236177 ATGATTGAATAAATGAATGAAGG - Intronic
1012013162 6:93818711-93818733 ATATTTACACACATGAATGATGG - Intergenic
1012254835 6:97019657-97019679 ATTTTTAAATAAATGCACCAAGG - Intronic
1012641895 6:101628575-101628597 ATGTGTAATCAAATGATCCAAGG + Intronic
1013062962 6:106655198-106655220 ATGTTTGAATGAATGAATGAGGG + Intronic
1013446528 6:110234287-110234309 ATATTAAAACAAATAAAACATGG - Intronic
1013632076 6:111995656-111995678 AGGTTTCAACATATGAATCTGGG + Intergenic
1013749282 6:113383653-113383675 AAGTTTAAACACATGAATTTTGG + Intergenic
1013780308 6:113721343-113721365 ATTTTTAAAAAAATAAATTATGG + Intergenic
1013784184 6:113760804-113760826 AAGTTTAAACTAATGGAACAGGG + Intergenic
1013898184 6:115118554-115118576 ATGTTTGAATAAATGAATACTGG + Intergenic
1014168329 6:118250668-118250690 ATGTAGAAAGAAATGAGTCATGG + Intronic
1014469023 6:121792142-121792164 TTGTTTAGACAAATGCCTCAGGG - Intergenic
1014535486 6:122608868-122608890 ATGTTTGAACTTATGAATTATGG - Intronic
1016488874 6:144573906-144573928 ATGATTAATCACATGAATCCTGG - Intronic
1016690066 6:146927589-146927611 CTGGTTGAACAAATGAATGAAGG - Intergenic
1017053972 6:150421368-150421390 TTGTTTAAACTAAAGAATCTTGG + Intergenic
1017559585 6:155612977-155612999 ATGTTTAAACAAGTTATGCAAGG - Intergenic
1018008746 6:159648548-159648570 ATGATGAAACAAATAATTCATGG - Intergenic
1018018532 6:159734766-159734788 AGGATTAAAAAATTGAATCAGGG - Intronic
1018196926 6:161363280-161363302 ATATTTAAATAAATAAATAAAGG + Intronic
1018387210 6:163315676-163315698 ATGTTTAAAAAAAAAAAACAAGG + Intergenic
1018778879 6:167044613-167044635 ATTTTTAAAAACATGTATCAGGG - Exonic
1020657477 7:10944534-10944556 ATGTTTTAACAAAGGTATGATGG - Intergenic
1021173754 7:17426114-17426136 AAGTTTCAACAAATGAATTTTGG - Intergenic
1021348106 7:19552831-19552853 ATTTTGAAAGAAATGAATGAAGG - Intergenic
1021640814 7:22734633-22734655 ATCTTTAAACAAACGAGGCAAGG - Intergenic
1022357156 7:29626862-29626884 ATGTTTACATCAATGAATCAAGG + Intergenic
1022431846 7:30331818-30331840 ATGTTAACACAAATGGAACACGG - Intronic
1022525724 7:31035786-31035808 AAGTTTCAACAAATGAATTCTGG + Intergenic
1022668373 7:32431910-32431932 ATATTTCAACATATGAATGAGGG + Intergenic
1023276227 7:38521560-38521582 ATTTTTTAACAAATGAAAAAAGG + Intronic
1023318341 7:38965458-38965480 ATAATTAAACAAATGAAAAATGG - Intergenic
1023470965 7:40518918-40518940 ATGCTTAAATAAATAAATTAGGG + Intronic
1024125782 7:46293318-46293340 ATAGTTAAACAACTGAAACAAGG - Intergenic
1024144275 7:46496295-46496317 AAGTTTAGACAAATGTATAATGG - Intergenic
1024350991 7:48363867-48363889 ATATTTAAACAATTTAAACAAGG - Intronic
1024657945 7:51467724-51467746 AGGTTTCAACAAATGAATCTGGG + Intergenic
1024718652 7:52109282-52109304 ACTTTTAAACAAGTGAATAAGGG - Intergenic
1025261613 7:57424077-57424099 ATGTATATAAAAATGAATCATGG + Intergenic
1026381107 7:69800296-69800318 AAGGTTAAACAAAAAAATCAAGG + Intronic
1026432676 7:70362772-70362794 ATGTTTAAAGCAATAAAACAAGG - Intronic
1027227715 7:76254905-76254927 AAGTTTAAACAAAGGAATGTGGG + Intronic
1027745384 7:82067326-82067348 ATGTTTAAACATATGACTCCTGG + Intronic
1028185378 7:87778960-87778982 ATGTTGAAAATAATGAATCTAGG - Intronic
1028663269 7:93309075-93309097 ATGTTTTAAAAAATGATTCCTGG + Intronic
1029179572 7:98690281-98690303 AAGTTTAAAAAAAAGAAACAGGG - Intergenic
1029870238 7:103683329-103683351 ATAGTTCAACAAATGAATGAGGG + Intronic
1029990182 7:104955929-104955951 ATGTTAAAAGAAATGTAACAGGG - Intergenic
1030369481 7:108682169-108682191 AGGTATAAACAAATGAATACAGG + Intergenic
1031488345 7:122356915-122356937 ATCTTTAATGAAATGAACCAGGG - Intronic
1031558237 7:123204985-123205007 AAGTTTAAAGAAATTAATGAGGG + Intergenic
1031793312 7:126137911-126137933 ATGCCTGAACAAATGAATGAAGG - Intergenic
1031856907 7:126933950-126933972 ATGTATCAACAAATATATCAAGG - Intronic
1033042646 7:137932191-137932213 ATGTTTAAATCAATGAAACAGGG - Intronic
1033462232 7:141557368-141557390 ATATTTTAACAAATGGAGCATGG + Intronic
1033824548 7:145173484-145173506 TTGATTAAATAAATGAATAAAGG - Intergenic
1034065667 7:148134374-148134396 ATGTTTAAACTAATGTATACAGG - Intronic
1034380318 7:150686616-150686638 ATGAGTAGACAAATGAAACATGG + Intronic
1035053628 7:156019098-156019120 ATGTTTAAGTAAATGAAGGAAGG + Intergenic
1037027761 8:14060329-14060351 AAGATGAAACAATTGAATCAGGG - Intergenic
1037108589 8:15139198-15139220 ATGTTTAAAGAATTGTATTAGGG - Intronic
1037174824 8:15934686-15934708 ATGTTTAAATATATGAATGTAGG + Intergenic
1037189509 8:16105811-16105833 GTGTTTAAAAAAATGAATGCAGG - Intergenic
1037221934 8:16534186-16534208 ATATTTACACAGATGAATCGGGG - Intronic
1037660797 8:20925080-20925102 ATGTTTAAACAAATAAAAGTGGG - Intergenic
1038423489 8:27449737-27449759 ATATTTATACAAATGAACCGTGG + Intronic
1039592749 8:38763801-38763823 ATGTAGAAAAAAATGAATTATGG - Intronic
1039693808 8:39888981-39889003 ATGTTTAGCCAAATTAATTAGGG + Intergenic
1040045167 8:42955529-42955551 TTGATTAAACAAATGAACCTAGG + Intronic
1040958326 8:53003778-53003800 ATCTTAAAACAGATTAATCAAGG - Intergenic
1042057574 8:64782246-64782268 AGGTTTCAACATATGAATCTTGG - Intronic
1042425552 8:68643749-68643771 ATGTTTCAACATATGAATTTGGG + Intronic
1043065489 8:75565558-75565580 ATTTTAAAACAAATGAAGCATGG + Exonic
1043376022 8:79650761-79650783 ATTTTTGAACAAATTATTCAGGG - Intronic
1043385089 8:79740659-79740681 ATGTTTAAGCAATTGGACCAAGG - Intergenic
1043659599 8:82721335-82721357 ATGTTAATATAAATGAAACATGG + Intergenic
1043945188 8:86242875-86242897 AAGGTTAAAAAAATAAATCAAGG + Intronic
1044229937 8:89762217-89762239 ATGAATAAACAAATGAACCTGGG + Intronic
1045446097 8:102265832-102265854 ATATTTGAAGAAATAAATCATGG - Intronic
1045723158 8:105138206-105138228 ATGTTTAAATAAATTAATATGGG + Intronic
1046037075 8:108855457-108855479 ATGATTAAAGAAATAAATGAAGG + Intergenic
1046390459 8:113565755-113565777 ATTTTTAAACAGCTCAATCAAGG - Intergenic
1046666921 8:117014462-117014484 ATGTTTAAACAGCTAACTCATGG - Intronic
1046761323 8:118024133-118024155 ATGTTTCAAAAAATAAACCACGG + Intronic
1046772039 8:118126023-118126045 GTGAATGAACAAATGAATCAAGG + Intergenic
1047021430 8:120778971-120778993 ATAAATAAACAAATGAATGATGG - Intronic
1050077994 9:1884586-1884608 AGGTTTTAACACATGAATCTGGG - Intergenic
1050209479 9:3237322-3237344 ATGTTGAGTCAAATGATTCATGG - Intronic
1050561410 9:6838189-6838211 ATGTTTAAAGAAATAAAAGACGG - Intronic
1050875150 9:10624399-10624421 ATGTTAAAACAAAGGAAACAGGG + Intergenic
1051493495 9:17693225-17693247 ATGTTTGGACACATGGATCAGGG + Intronic
1051928323 9:22354997-22355019 ATGATTAAATATATGATTCAAGG - Intergenic
1052194147 9:25691821-25691843 ATGTTTAAAAAAATTAAGCTTGG - Intergenic
1052341916 9:27372084-27372106 TTTTTTAAATAAAGGAATCAGGG + Intronic
1052427766 9:28326975-28326997 ATTTTTCAACAAATGAATTTTGG - Intronic
1052585063 9:30416511-30416533 ATGTTTAAAATAAAGAATAAAGG + Intergenic
1052709521 9:32036590-32036612 ATGTTTTATCTAATGAGTCACGG - Intergenic
1053882373 9:42608804-42608826 ATGTTTGTATAATTGAATCAAGG - Intergenic
1053890296 9:42685489-42685511 ATGTTTGTATAATTGAATCAAGG + Intergenic
1054221398 9:62416272-62416294 ATGTTTGTATAATTGAATCAAGG - Intergenic
1054229316 9:62492901-62492923 ATGTTTGTATAATTGAATCAAGG + Intergenic
1054717791 9:68574285-68574307 ATGGGAAAACAAATGAACCAAGG + Intergenic
1054918877 9:70522019-70522041 ATGAATGAACAAATGAATAATGG - Intergenic
1054999636 9:71434218-71434240 AAGTTTAAACATATGAATTTTGG - Intronic
1055331288 9:75186355-75186377 ATCTGTAAAGAATTGAATCATGG - Intergenic
1055370536 9:75593633-75593655 ATGTTTCAACATATGAATTTGGG - Intergenic
1057062186 9:92015247-92015269 ATGTTAAAAAAAAGGAATAAAGG + Intergenic
1058142712 9:101375071-101375093 AGGTGGAAATAAATGAATCACGG + Intronic
1058166053 9:101620394-101620416 AGGTTTCAACATATGAATCTGGG + Intronic
1058977809 9:110140947-110140969 AAGTTTCAACAAATGAATAATGG + Intronic
1059090079 9:111347141-111347163 ATTTTTAAAAAATGGAATCAGGG + Intergenic
1059578256 9:115515495-115515517 ATATTTAAAAAAATCAATTATGG - Intergenic
1059619691 9:115989780-115989802 AAGTTTCAACATATGAATCTGGG - Intergenic
1059755071 9:117285373-117285395 ATGATTAAATCAATGAATGAAGG + Intronic
1060399070 9:123337120-123337142 ATGAATGAACAAATGAATGAAGG - Intergenic
1060617904 9:125035754-125035776 ATGATTAATAAAATGAATAATGG + Intronic
1060664465 9:125424473-125424495 ATAATTAAATAAATGAATAAGGG - Intergenic
1060810129 9:126607109-126607131 ATTTTAAAGCAAATAAATCAAGG + Intergenic
1060896476 9:127221369-127221391 TTTTTTAAGCAAATGGATCATGG + Exonic
1062471077 9:136704955-136704977 AGGTTTCAACCAATCAATCACGG + Intergenic
1203774130 EBV:63340-63362 CTGTTTATCCTAATGAATCACGG + Intergenic
1185745304 X:2567825-2567847 ATGTTCAAAAAAAAGAACCAGGG + Intergenic
1185883876 X:3764536-3764558 ATGGATAGATAAATGAATCATGG - Intergenic
1186014994 X:5181288-5181310 ATTTTTAAAAGAATGAATAAGGG + Intergenic
1186018799 X:5230013-5230035 ATGTCTAAATAAAAGAATCTTGG + Intergenic
1187228559 X:17398343-17398365 ATCTTTAAACAAGAGAAACAAGG - Intronic
1187841053 X:23488657-23488679 ATGATTAGATAAATAAATCATGG + Intergenic
1187909286 X:24095828-24095850 ATTTTGAAAAAAATGAATAAAGG - Intergenic
1188029951 X:25253202-25253224 ATGAATGAACAAATGAATGAGGG + Intergenic
1188272494 X:28157998-28158020 ATGTGTAAATAAAGTAATCAAGG - Intergenic
1188553687 X:31387911-31387933 ATGTTGAAATAAATAAAGCAAGG - Intronic
1188801995 X:34543808-34543830 AAGTTTCAACATATGATTCAGGG + Intergenic
1189780481 X:44509247-44509269 ATGTTTAAAAAAATAATTAAAGG - Intergenic
1190806622 X:53844067-53844089 ATGTTTAAAGAAATAACTCTAGG - Intergenic
1192264177 X:69527612-69527634 ATATTTTAACAAATGCTTCAGGG + Intronic
1193349343 X:80441576-80441598 TTGTCTAAACAAATAAATCTAGG - Intronic
1193395244 X:80976491-80976513 ATGCTTCAACAAATGAAGCTGGG - Intergenic
1193450643 X:81660508-81660530 ATATTTCAACCAATGAATAATGG + Intergenic
1193878044 X:86886323-86886345 GGGTTTAAACAAATGTATAAGGG - Intergenic
1194083904 X:89502469-89502491 AAGTTTCAACATATGAATTATGG - Intergenic
1195023633 X:100853840-100853862 ATTTTAAAACAAATGTTTCAAGG + Intronic
1195204468 X:102582460-102582482 CTGTTTTGACAAATGATTCAAGG + Intergenic
1195930119 X:110065991-110066013 ATGTTTAATGAAATTGATCAAGG + Intronic
1196021786 X:110998525-110998547 AAGTATAAACAAATGCTTCAAGG + Intronic
1196239421 X:113324462-113324484 ATCTTTGAAGAAATGATTCAGGG + Intergenic
1196323235 X:114368956-114368978 AGGTTTCAACATATGAATCTAGG + Intergenic
1197001542 X:121445620-121445642 GTGTATAAACAAGTGAATAATGG + Intergenic
1197078638 X:122384587-122384609 ATATTTAAACATATGAACCACGG + Intergenic
1197289103 X:124632902-124632924 ATTTTTACACAATTGAATTATGG + Intronic
1197972361 X:132128670-132128692 ATCTATAAAGAAATGAAACAAGG + Intergenic
1199043653 X:143143365-143143387 AGGTTTAAACAAATGATGAAAGG - Intergenic
1199812337 X:151362555-151362577 ATGATTAAACAAAAAAATCCCGG + Intergenic
1200245203 X:154519968-154519990 ATATTTACACAAATAAATAAAGG + Intergenic
1200376715 X:155788559-155788581 ATGTTTAAGAAAATGAAAGAAGG - Intergenic
1200436551 Y:3158349-3158371 AAGTTTCAACATATGAATTATGG - Intergenic
1200781544 Y:7220755-7220777 ATGGATAGATAAATGAATCATGG + Intergenic
1201910142 Y:19125496-19125518 AGGTTTAAACAAATGAATTTTGG - Intergenic
1202276594 Y:23127060-23127082 ATTTTTAAACAAATGTACAAGGG + Intergenic
1202289434 Y:23293630-23293652 ATTTTTAAACAAATGTACAAGGG - Intergenic
1202429587 Y:24760782-24760804 ATTTTTAAACAAATGTACAAGGG + Intergenic
1202441204 Y:24909309-24909331 ATTTTTAAACAAATGTACAAGGG - Intergenic