ID: 925988407

View in Genome Browser
Species Human (GRCh38)
Location 2:9234462-9234484
Sequence CTATTATCAAGGCCCCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 113}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925988407_925988417 25 Left 925988407 2:9234462-9234484 CCTTGCAGGGGCCTTGATAATAG 0: 1
1: 0
2: 0
3: 6
4: 113
Right 925988417 2:9234510-9234532 CACTTCCTGCTGGGGCAGCTGGG 0: 1
1: 0
2: 5
3: 26
4: 334
925988407_925988415 17 Left 925988407 2:9234462-9234484 CCTTGCAGGGGCCTTGATAATAG 0: 1
1: 0
2: 0
3: 6
4: 113
Right 925988415 2:9234502-9234524 GGAGAGATCACTTCCTGCTGGGG 0: 1
1: 1
2: 5
3: 27
4: 235
925988407_925988411 -5 Left 925988407 2:9234462-9234484 CCTTGCAGGGGCCTTGATAATAG 0: 1
1: 0
2: 0
3: 6
4: 113
Right 925988411 2:9234480-9234502 AATAGGAGGAGCTCAGAAGCAGG 0: 1
1: 0
2: 1
3: 18
4: 225
925988407_925988412 -4 Left 925988407 2:9234462-9234484 CCTTGCAGGGGCCTTGATAATAG 0: 1
1: 0
2: 0
3: 6
4: 113
Right 925988412 2:9234481-9234503 ATAGGAGGAGCTCAGAAGCAGGG 0: 1
1: 1
2: 1
3: 21
4: 295
925988407_925988414 16 Left 925988407 2:9234462-9234484 CCTTGCAGGGGCCTTGATAATAG 0: 1
1: 0
2: 0
3: 6
4: 113
Right 925988414 2:9234501-9234523 GGGAGAGATCACTTCCTGCTGGG 0: 1
1: 0
2: 2
3: 29
4: 190
925988407_925988413 15 Left 925988407 2:9234462-9234484 CCTTGCAGGGGCCTTGATAATAG 0: 1
1: 0
2: 0
3: 6
4: 113
Right 925988413 2:9234500-9234522 AGGGAGAGATCACTTCCTGCTGG 0: 1
1: 0
2: 4
3: 48
4: 310
925988407_925988416 24 Left 925988407 2:9234462-9234484 CCTTGCAGGGGCCTTGATAATAG 0: 1
1: 0
2: 0
3: 6
4: 113
Right 925988416 2:9234509-9234531 TCACTTCCTGCTGGGGCAGCTGG 0: 1
1: 0
2: 1
3: 39
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925988407 Original CRISPR CTATTATCAAGGCCCCTGCA AGG (reversed) Intronic
904342186 1:29843777-29843799 CTATTATCATGACCCATGCTGGG + Intergenic
904365966 1:30010958-30010980 CTATCATGCTGGCCCCTGCAGGG - Intergenic
912234518 1:107835172-107835194 CCGCTATCAAGGCCCCTGCCTGG + Intronic
914271601 1:146085918-146085940 CTATTCTCATGGCGACTGCATGG - Intronic
914585844 1:149061084-149061106 CTATTCTCATGGCGACTGCATGG - Intronic
916842639 1:168615498-168615520 CTATTATCCTGAACCCTGCATGG - Intergenic
917012957 1:170496064-170496086 CTATCACCAAGGCCCCTGTCAGG + Intergenic
923525067 1:234766283-234766305 CTAATATCAAGGTGCCAGCAGGG - Intergenic
924582494 1:245334553-245334575 CTCTTCTGAAGGCTCCTGCAGGG - Intronic
1062788758 10:287580-287602 CTATTATAAAGTTGCCTGCATGG - Intronic
1069830131 10:71277864-71277886 CTCTCATCAAGGGACCTGCAAGG - Intronic
1075481970 10:122789741-122789763 CTAGTGTCCAGGCCCCTGCTGGG - Intergenic
1076435049 10:130434863-130434885 CTATCATCAAGACCCCTTCGAGG - Intergenic
1078249513 11:9605582-9605604 CTGAAATTAAGGCCCCTGCAGGG + Intergenic
1084116553 11:67045950-67045972 CTCTTCTCAGGGCCCCTGCAGGG + Intronic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1089916849 11:122165245-122165267 ATATTGTCATGGCCCCTTCAGGG - Intergenic
1092323251 12:7501287-7501309 CTGCTATCAAAGCCCCTGGATGG - Exonic
1094001467 12:25699349-25699371 ATATTTTCAAAACCCCTGCATGG - Intergenic
1102258131 12:111428057-111428079 CTGTTAACTAGGGCCCTGCATGG + Intronic
1102806791 12:115788612-115788634 CTCTTCTCACGGCCCCTGAATGG - Intergenic
1106679860 13:31998831-31998853 CTATGATCAAGGTGCCTGCATGG + Intergenic
1108545303 13:51487657-51487679 CTCCTCTCAAGGCACCTGCAAGG - Intergenic
1110672362 13:78195576-78195598 ATATTATCAAGATCACTGCAGGG - Intergenic
1110838966 13:80119577-80119599 CTGGGATCAAGGACCCTGCATGG - Intergenic
1112285913 13:98104427-98104449 TTATTCTCATGGCCCGTGCAGGG + Intergenic
1113947852 13:114054523-114054545 CTGTCATTAAGGCCGCTGCAGGG - Intronic
1114743053 14:25117942-25117964 CTAAAATCAAGGCACCGGCAAGG - Intergenic
1115289218 14:31751685-31751707 CTATTCTCCAGACCCCAGCATGG - Intronic
1118951998 14:70443362-70443384 GTATTATCAAGGCCCCACTAGGG + Intergenic
1120151140 14:81035390-81035412 CCATTATCAGGTCTCCTGCAAGG - Intronic
1121643702 14:95503118-95503140 CTACCCTCAAGTCCCCTGCAAGG + Intergenic
1122866764 14:104609338-104609360 CTAAAATCAAGGCATCTGCAGGG + Intergenic
1126974776 15:54163353-54163375 CTATAATTAAGGTCTCTGCAAGG - Intronic
1127543676 15:59968683-59968705 TTATTACCAGGGCTCCTGCAAGG - Intergenic
1133436622 16:5785468-5785490 ATATTATCAGGGTCTCTGCATGG + Intergenic
1134538551 16:15046105-15046127 CTATCATCTTGGCCCCCGCAGGG - Intronic
1134761405 16:16718200-16718222 CATTTGTCAAGGCCTCTGCAGGG + Intergenic
1134984654 16:18640970-18640992 CATTTGTCAAGGCCTCTGCAGGG - Intergenic
1135042975 16:19132113-19132135 CCATGATCAAAGCCCCTGGAAGG + Intronic
1136485657 16:30570297-30570319 CTATTAGCGTGGCCCCGGCACGG - Exonic
1138803867 16:60069628-60069650 CTATTTTCAAGACCACTACATGG - Intergenic
1139926569 16:70491175-70491197 GTATTATCAAGCCCAGTGCACGG + Intronic
1140963127 16:79936549-79936571 CCATTTTCAAGACCCCGGCAAGG + Intergenic
1154035654 18:10799338-10799360 CTATTGTCATTGCCCCTGCAAGG - Intronic
1158988010 18:62838689-62838711 CTCTGATCAAGGAGCCTGCATGG - Intronic
1159265898 18:66078396-66078418 CTATTCTCAAGTCTTCTGCATGG - Intergenic
1159568405 18:70083146-70083168 CTGGTATCAAGGCCCCTGGTAGG + Intronic
1161606132 19:5215839-5215861 CTGTGATCCAGGCCCCTCCAGGG - Intronic
1168189394 19:54726842-54726864 CTAAAATCAAGGCATCTGCAGGG - Intronic
1168191400 19:54741015-54741037 CTAAAATCAAGGCATCTGCAGGG - Intronic
1168193670 19:54757643-54757665 CTAAAATCAAGGCATCTGCAGGG - Intronic
1168195731 19:54772382-54772404 GTAAAATCAAGGCACCTGCAGGG - Intronic
1168197623 19:54787233-54787255 CTAAAATCAAGGCATCTGCAGGG - Intronic
1168199674 19:54805558-54805580 CTACAATCAAGGCATCTGCAGGG - Intronic
1168204102 19:54836612-54836634 CTAAAATCAAGGCATCTGCAGGG - Intronic
1168320329 19:55505529-55505551 CTAAGATCAAGGCGCCAGCAGGG + Intronic
925988407 2:9234462-9234484 CTATTATCAAGGCCCCTGCAAGG - Intronic
926942717 2:18155082-18155104 CTGAAATCAAGGCACCTGCAGGG - Intronic
929299588 2:40287876-40287898 CTCTGATCAGGGCTCCTGCAGGG + Intronic
935070762 2:99691789-99691811 CTATGATCATGGGCTCTGCAGGG - Intronic
937005435 2:118508293-118508315 CTCTTCTCAAAGCCCCTCCATGG + Intergenic
937090549 2:119203359-119203381 CTATTACACAGGCCCCTGCATGG + Intergenic
937467693 2:122149100-122149122 CCATGATCAAGGCGCCAGCAGGG - Intergenic
941870127 2:170375411-170375433 CTAGTACCAAGCCACCTGCAGGG - Intronic
942419237 2:175791093-175791115 CTAGGATCAAGGCCTCAGCAGGG + Intergenic
942779532 2:179624848-179624870 CTATCATCTAGGCCCTTGCTAGG + Intronic
947459037 2:230286571-230286593 CTTTCATCAAGTCCACTGCAAGG + Intronic
947469324 2:230386043-230386065 CTTTCATCAAGTCCACTGCAAGG + Intronic
948580323 2:238983037-238983059 CTATTATAAAGACACATGCACGG - Intergenic
1169302583 20:4457072-4457094 CTATTATAAAGACACGTGCATGG + Intergenic
1170609874 20:17903804-17903826 AGATTAGCATGGCCCCTGCAAGG + Intergenic
1172818536 20:37711003-37711025 CTATTATTAAGGGCTCTGCATGG + Intronic
1173571071 20:44076405-44076427 CCATGATCAAGGCACCCGCATGG - Intergenic
1178217016 21:30610967-30610989 CTATTATAAAGACACATGCATGG + Intergenic
1178272445 21:31203879-31203901 CTATTAGCACTGCCCCTGGAGGG - Intronic
1178496533 21:33090795-33090817 CTATTTTCAGGGTCCCTGGAGGG - Intergenic
1179525822 21:41975250-41975272 CTTATATTAAGGTCCCTGCATGG + Intergenic
1183428098 22:37750420-37750442 CTGTGGTCAAGCCCCCTGCAAGG + Intronic
1185093562 22:48791913-48791935 CTATTATCAAGGCCTAGGAATGG - Intronic
1185411944 22:50687301-50687323 CTGCTCTCAAGGCCACTGCAGGG + Intergenic
959112119 3:102134335-102134357 GGATTCTGAAGGCCCCTGCAGGG + Intronic
960914076 3:122679775-122679797 CTATTATCCAGCCACTTGCACGG + Intergenic
962389555 3:134959818-134959840 TTTGTATCAAGGACCCTGCATGG + Intronic
966201021 3:177359690-177359712 CTAAGAGGAAGGCCCCTGCAGGG + Intergenic
973167625 4:47096886-47096908 GTAAAATCAAGGCCCGTGCAGGG - Intronic
974124977 4:57685041-57685063 CTAAGATCAAGACCCCAGCATGG - Intergenic
977991022 4:103442635-103442657 CTAATATCAGGGTCCCAGCATGG + Intergenic
978861440 4:113454462-113454484 CTGTTCTCAAGGCACCTGGATGG - Exonic
980990197 4:139733011-139733033 GAAATATCTAGGCCCCTGCAAGG - Intronic
981502206 4:145463788-145463810 CCATTACCAAGTCTCCTGCAAGG - Intergenic
982957272 4:161787229-161787251 CTCTTATCAAGGCCTCTACCAGG - Intronic
983438449 4:167748566-167748588 AAACTATCAAGGCCCTTGCAGGG + Intergenic
983653349 4:170055281-170055303 CTAGGATCAAGGTGCCTGCAGGG - Intergenic
986807824 5:11325655-11325677 CAATTTTCAAGGCTCCTGTAGGG - Intronic
987095574 5:14546363-14546385 ATATTATCATCTCCCCTGCAGGG - Intergenic
987970789 5:24941122-24941144 CTATAATCATGGCCCTTTCATGG - Intergenic
987994155 5:25253104-25253126 CTATTATAAAGACACATGCATGG + Intergenic
993342362 5:86740410-86740432 CTATTGTCAAAGCACTTGCAAGG + Intergenic
1005243670 6:23857845-23857867 CTATTATAAAGACACATGCATGG + Intergenic
1006514737 6:34539548-34539570 CTTTCATCCAGGCCGCTGCAGGG + Exonic
1013670868 6:112401042-112401064 CTAAAATCAAGGCCCTGGCAGGG + Intergenic
1013743831 6:113320890-113320912 CTAATATCAAGGTGCCAGCAGGG - Intergenic
1018579490 6:165296490-165296512 ATATTCTCATGGCCCCTACAGGG - Intronic
1018720601 6:166569216-166569238 CCAGTCTCAAGGCCCCTGCGGGG - Intronic
1019613198 7:1947231-1947253 CTATCCTCAAGGTCCCTGCTGGG + Intronic
1020352074 7:7231972-7231994 CTCTTATCAAGGACTCTGAAAGG - Intronic
1023615878 7:42018942-42018964 CGATTGCCAAGGGCCCTGCAGGG + Intronic
1034519518 7:151608514-151608536 CTATAATCCAGGCCCCTGGAAGG + Intronic
1039800426 8:40949945-40949967 CTAAAATCAAGGCATCTGCAGGG - Intergenic
1043561171 8:81495133-81495155 CTATCATCAAGGACCCAGCTTGG + Intergenic
1045406270 8:101869445-101869467 CTAAAATCAAGGTCCCAGCAGGG - Intronic
1048703435 8:137121140-137121162 CTCTTATCCAGGCCCCCGAAGGG - Intergenic
1050344092 9:4669208-4669230 CTAAAATCAAGGTGCCTGCAGGG + Intergenic
1057082122 9:92180920-92180942 CTGTTAGCAAGCCCACTGCACGG + Intergenic
1062397645 9:136358837-136358859 CTCCTGTCGAGGCCCCTGCAGGG - Exonic
1185660282 X:1722388-1722410 CTATTATAAAGACACGTGCAAGG - Intergenic
1188960142 X:36481486-36481508 CTAATATCAAGGTACCTACAAGG + Intergenic
1193781244 X:85703874-85703896 CTAAGATCAAGGTCCATGCAGGG - Intergenic
1196316809 X:114236433-114236455 CTAATATCAAGTCCCTTGGATGG + Intergenic