ID: 925989224

View in Genome Browser
Species Human (GRCh38)
Location 2:9240370-9240392
Sequence GATCCCAGCTACCGGGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3321
Summary {0: 1, 1: 5, 2: 74, 3: 978, 4: 2263}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925989224_925989234 22 Left 925989224 2:9240370-9240392 CCACCTCCCCGGTAGCTGGGATC 0: 1
1: 5
2: 74
3: 978
4: 2263
Right 925989234 2:9240415-9240437 AGCTAATTTTTTGTAGAGATGGG 0: 131
1: 474
2: 1001
3: 2801
4: 12476
925989224_925989235 23 Left 925989224 2:9240370-9240392 CCACCTCCCCGGTAGCTGGGATC 0: 1
1: 5
2: 74
3: 978
4: 2263
Right 925989235 2:9240416-9240438 GCTAATTTTTTGTAGAGATGGGG 0: 258
1: 611
2: 1967
3: 8782
4: 33756
925989224_925989233 21 Left 925989224 2:9240370-9240392 CCACCTCCCCGGTAGCTGGGATC 0: 1
1: 5
2: 74
3: 978
4: 2263
Right 925989233 2:9240414-9240436 AAGCTAATTTTTTGTAGAGATGG 0: 3
1: 185
2: 595
3: 1318
4: 5131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925989224 Original CRISPR GATCCCAGCTACCGGGGAGG TGG (reversed) Intronic