ID: 925989224 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:9240370-9240392 |
Sequence | GATCCCAGCTACCGGGGAGG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 3321 | |||
Summary | {0: 1, 1: 5, 2: 74, 3: 978, 4: 2263} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
925989224_925989234 | 22 | Left | 925989224 | 2:9240370-9240392 | CCACCTCCCCGGTAGCTGGGATC | 0: 1 1: 5 2: 74 3: 978 4: 2263 |
||
Right | 925989234 | 2:9240415-9240437 | AGCTAATTTTTTGTAGAGATGGG | 0: 131 1: 474 2: 1001 3: 2801 4: 12476 |
||||
925989224_925989235 | 23 | Left | 925989224 | 2:9240370-9240392 | CCACCTCCCCGGTAGCTGGGATC | 0: 1 1: 5 2: 74 3: 978 4: 2263 |
||
Right | 925989235 | 2:9240416-9240438 | GCTAATTTTTTGTAGAGATGGGG | 0: 258 1: 611 2: 1967 3: 8782 4: 33756 |
||||
925989224_925989233 | 21 | Left | 925989224 | 2:9240370-9240392 | CCACCTCCCCGGTAGCTGGGATC | 0: 1 1: 5 2: 74 3: 978 4: 2263 |
||
Right | 925989233 | 2:9240414-9240436 | AAGCTAATTTTTTGTAGAGATGG | 0: 3 1: 185 2: 595 3: 1318 4: 5131 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
925989224 | Original CRISPR | GATCCCAGCTACCGGGGAGG TGG (reversed) | Intronic | ||