ID: 925989884

View in Genome Browser
Species Human (GRCh38)
Location 2:9246104-9246126
Sequence CTGAAGTCAAGCAGCTGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 182}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925989884_925989888 13 Left 925989884 2:9246104-9246126 CCTGATCAGCTGCTTGACTTCAG 0: 1
1: 0
2: 1
3: 18
4: 182
Right 925989888 2:9246140-9246162 TTTGAGTGAAAAAATGAATGGGG 0: 1
1: 0
2: 4
3: 75
4: 713
925989884_925989887 12 Left 925989884 2:9246104-9246126 CCTGATCAGCTGCTTGACTTCAG 0: 1
1: 0
2: 1
3: 18
4: 182
Right 925989887 2:9246139-9246161 ATTTGAGTGAAAAAATGAATGGG 0: 1
1: 0
2: 1
3: 96
4: 657
925989884_925989886 11 Left 925989884 2:9246104-9246126 CCTGATCAGCTGCTTGACTTCAG 0: 1
1: 0
2: 1
3: 18
4: 182
Right 925989886 2:9246138-9246160 CATTTGAGTGAAAAAATGAATGG 0: 1
1: 0
2: 8
3: 56
4: 668
925989884_925989889 26 Left 925989884 2:9246104-9246126 CCTGATCAGCTGCTTGACTTCAG 0: 1
1: 0
2: 1
3: 18
4: 182
Right 925989889 2:9246153-9246175 ATGAATGGGGATTCTCTGTATGG 0: 1
1: 0
2: 1
3: 12
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925989884 Original CRISPR CTGAAGTCAAGCAGCTGATC AGG (reversed) Intronic
900942320 1:5807797-5807819 CTGAAGTCAATTAGCTGCTGAGG - Intergenic
901152085 1:7110478-7110500 CAGAAGGCAAGGAGCTGAACTGG - Intronic
901160616 1:7174096-7174118 CTGAGGAAAAACAGCTGATCAGG + Intronic
901492562 1:9603825-9603847 CTGAAGCCACGCAGGTCATCGGG - Intronic
902721533 1:18307534-18307556 CAGCAGGCAAGCAGCTGAGCCGG + Intronic
904008851 1:27378655-27378677 CTGAAGTCACACAGCTGGACAGG - Intergenic
905198840 1:36302701-36302723 CTGAAGTCATGGGGCTGATAAGG + Intronic
908223407 1:62032119-62032141 CTGAAGTCAAGGCGTTGGTCAGG + Intronic
912561078 1:110551936-110551958 CTGAGGTCAGACAGCTGGTCAGG - Intergenic
913320704 1:117586627-117586649 CTGAAGTCAAGGAGAGGATTGGG + Intergenic
913479903 1:119278054-119278076 CTGAAGGGAAGCAGATGAACTGG - Intergenic
914940687 1:152020387-152020409 CTGAAGTACAGCAGCTCAGCCGG + Intergenic
922863132 1:228836579-228836601 CTGAAGTCACTCTGCTTATCAGG - Intergenic
924616049 1:245612973-245612995 CTGGAGACATTCAGCTGATCTGG - Intronic
1065240672 10:23700688-23700710 GAGAAGTCAAGCAGGTTATCTGG - Intronic
1066248898 10:33613970-33613992 CAGAAATCAAACAGCTGATCTGG + Intergenic
1067781287 10:49209235-49209257 CTGTAGTCAAGCAGCACATGGGG + Intergenic
1067800013 10:49352440-49352462 CTGCAGTCAAGCTGTTGACCTGG + Intergenic
1067933138 10:50583453-50583475 CTGGAGTGAAGCACATGATCTGG + Intronic
1069306966 10:66982851-66982873 CTGAAGTCCTTCAGCTGACCTGG + Intronic
1071248587 10:83791622-83791644 GTGAAGGCAAGCAGCTGTTAGGG + Intergenic
1073075544 10:100823916-100823938 CAGAAGTCCAGCAGCTGGTGGGG + Intronic
1073255121 10:102146096-102146118 CTGGAGTGTAGTAGCTGATCAGG + Intronic
1074551005 10:114442359-114442381 CTCAAGCCCAGCAGCTTATCAGG - Intronic
1075441128 10:122480159-122480181 CTGAAGTCACACAGCTGTACGGG + Intronic
1076299541 10:129414647-129414669 CTGCAGAGAAGCCGCTGATCTGG - Intergenic
1076540478 10:131211297-131211319 CTGATGTGAGGCATCTGATCCGG - Intronic
1079278198 11:19061565-19061587 CTGAGGTCACCCAGCTGCTCTGG - Intergenic
1083116761 11:60467596-60467618 CTGAAGTCAAGCAGCAGGGAAGG - Intronic
1086029896 11:82341783-82341805 CTAAATTCAAAAAGCTGATCCGG + Intergenic
1087704117 11:101469384-101469406 ATGAAGTCATGCACATGATCGGG - Intronic
1088003183 11:104907467-104907489 CTGAAGGAAAGCAGCCCATCTGG + Intergenic
1090206690 11:124888053-124888075 CTGAAGTCACACAGCTGAGCTGG - Intronic
1091404841 12:202779-202801 CAGAAGTGAAGGAGCTGAACAGG + Exonic
1092617468 12:10228630-10228652 CTCTAGTCAAGCAGCAGAGCTGG - Intergenic
1096779523 12:53984203-53984225 CTGAAGTAAAGCAGCAGAACCGG + Intergenic
1100330754 12:93579766-93579788 CTGAAGTCATGGAGCAGAGCTGG + Intronic
1100351194 12:93784635-93784657 CTGAAGTCAAGCAGAAGAGATGG + Intronic
1101573843 12:105979722-105979744 CTGAAGACAAGGAACTGAACAGG - Intergenic
1101823195 12:108200011-108200033 CTAAAGTCACACAGCTAATCTGG + Intronic
1111373915 13:87353581-87353603 CTGAACTCTAGTAGCTCATCTGG + Intergenic
1112158012 13:96838486-96838508 CTGAAGACATGCAGTTGCTCTGG - Exonic
1112329364 13:98465057-98465079 CTCAAGGCAGGCAGCTGACCAGG - Intronic
1113735213 13:112673659-112673681 CTGAAGTCAAGGTGCTGCTGGGG + Intronic
1113810787 13:113141265-113141287 CTGAGGTTAAACAGCAGATCTGG - Intronic
1117571283 14:57051582-57051604 CTGCAGTCACTCAGCTCATCAGG + Intergenic
1118116669 14:62785432-62785454 CTGTAGTCAAGTAGATGAACCGG - Intronic
1121707754 14:96011819-96011841 GTGAAGTCCAGCAGCTGAGGTGG - Intergenic
1121930093 14:97964450-97964472 CCGAAGTCAAGCAGCTGATGAGG + Intronic
1124180127 15:27465379-27465401 CTGAGGGAAAGCAGCTGAGCTGG - Intronic
1125900970 15:43346767-43346789 CTGAGGTCAATCAGCTAAGCTGG - Intronic
1126069672 15:44854918-44854940 CTGAGGTCACGCAGCTGGTGGGG - Intergenic
1126088859 15:45034244-45034266 CTGAGGTCACGCAGCTGGTGGGG + Intronic
1126346432 15:47699413-47699435 CTGAGGTCAAACAGCTGTTAAGG + Intronic
1127819404 15:62641784-62641806 CTCAAGTCACGCAGCTGGTAAGG + Intronic
1130826116 15:87548001-87548023 CTGAAGTCAGGCTGCTTAACAGG - Intergenic
1131300883 15:91198821-91198843 CTGTATGCATGCAGCTGATCTGG + Intronic
1132748613 16:1447219-1447241 CTGAAGTCAAGGGGCTGAGGGGG - Intronic
1133716188 16:8451500-8451522 CTGAATTCAAGGAGCTTATGAGG + Intergenic
1134071181 16:11260785-11260807 CTGAAGCCACACAGCTGATGGGG - Intronic
1136912167 16:34153545-34153567 TTTAAGTCAAGGAGCTGATCAGG - Intergenic
1137735180 16:50718624-50718646 CTGAGGTCACGCAGCTAATGAGG - Intronic
1141441155 16:84030506-84030528 GGGAAGTCAAGCAGCTGGGCAGG - Intronic
1142846888 17:2685747-2685769 CTGAAGGAAAGCAGCTCATGAGG - Intergenic
1146018179 17:29250105-29250127 CTGAAGTTAAGCTGTTGACCTGG + Intronic
1146461760 17:33051538-33051560 CTGTAGGCAAGCACCTCATCTGG + Intronic
1147566240 17:41537976-41537998 CTGAGGTCAGGAAGCTGGTCTGG + Intergenic
1148187894 17:45657747-45657769 CTCAGGTCAAGCAGCTGAGGTGG + Intergenic
1148914752 17:50966563-50966585 CTGAAGTCAAGCAGTGGCTTGGG - Intronic
1148964199 17:51421007-51421029 CTGAGGTCACGCAGCTGATAAGG + Intergenic
1149523555 17:57336918-57336940 TTGAAGTTAAGCAGCTGTTCTGG + Intronic
1151745974 17:76011987-76012009 CTGAAGGCAAGCTGCTTACCTGG + Exonic
1152123411 17:78432617-78432639 CTGATGTCAAGCACCTGGCCTGG - Intronic
1152157906 17:78646871-78646893 TTGAATTCAAACAGCAGATCTGG + Intergenic
1155571582 18:27200638-27200660 CTGAAATCAAGGTGTTGATCAGG + Intergenic
1157947092 18:51992518-51992540 GTGAAGTCAAGCAACGGATTGGG + Intergenic
1158350640 18:56561918-56561940 CTAAAGTCACGCAGCTGAAATGG - Intergenic
1158656337 18:59338859-59338881 TTGAAATCAAGCAGCTGAACCGG - Exonic
1163642597 19:18470019-18470041 CTAAAGTGAAGCAGCTGGCCAGG + Intronic
1165017754 19:32894874-32894896 GTGAAGTCAAGAACCTGAACTGG + Intronic
1165685008 19:37812424-37812446 CTGAAAACATGCAGCTGGTCAGG + Intronic
1165925070 19:39321296-39321318 CTGAGGTCAAGCAGGAGAGCAGG - Intergenic
1165985886 19:39768551-39768573 GTGAAGTCAAGAACCTGAACTGG + Intergenic
1167723416 19:51194639-51194661 GTGAAGTCAAGAACCTGAACTGG - Intergenic
925274536 2:2639402-2639424 CAGAGGTCATGCAGGTGATCGGG + Intergenic
925989884 2:9246104-9246126 CTGAAGTCAAGCAGCTGATCAGG - Intronic
927492521 2:23529984-23530006 CTGAAGTGCCGCAGCTGAGCCGG - Intronic
928358474 2:30643145-30643167 CTGCAGACAAGCAGCTGCTCTGG - Exonic
929667316 2:43843102-43843124 CTGACCTCAAGCATCTGACCAGG - Intronic
931827836 2:66019795-66019817 CAGAAGTCAAGGTGCTGATAGGG + Intergenic
931834093 2:66081002-66081024 CTAAAGTGAAGGAGCTGAGCTGG - Intergenic
932955307 2:76344749-76344771 CTGAACTAAAGCAGCACATCTGG - Intergenic
934980262 2:98833643-98833665 CTGAACTCAAGAATCTGATCTGG + Intronic
935342383 2:102069463-102069485 CTGCAGTCAGGCTGCTTATCAGG - Intronic
938150359 2:128876817-128876839 CTGCAGTCAAGGAGCTGGTATGG - Intergenic
941958505 2:171229569-171229591 TTGAAGTCCAGTAGCTCATCAGG - Intronic
942451161 2:176108554-176108576 CTGGAGTCAAGCAGATGCCCCGG + Intronic
944480256 2:200149920-200149942 CTAAAGTCTAGCAACTGAGCAGG - Intergenic
947510765 2:230752413-230752435 CTGAATGCCAGCACCTGATCTGG - Intronic
947527653 2:230889009-230889031 CTGGAGTCAAGCATGTGACCAGG + Intergenic
1169425355 20:5492647-5492669 CTGAAATCCACAAGCTGATCAGG - Intergenic
1170108460 20:12778402-12778424 TTGAAGTGAAGCAGATGATAAGG - Intergenic
1170650707 20:18238006-18238028 ATGAAGTCAAGAACCTGATCCGG + Intergenic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1174644995 20:52078136-52078158 CTGAGGTCAAGCAACTTGTCAGG - Intronic
1175024861 20:55891133-55891155 CTGAAGTCAAGCTGCTGGCCAGG + Intergenic
1175744014 20:61441302-61441324 CTGAAGCCAAGGGGCTGACCTGG - Intronic
1176552239 21:8231018-8231040 TTGAAGTCGAGGAGCTTATCGGG - Intergenic
1176552643 21:8235555-8235577 TTGAAGTCGAGGAGCTTATCGGG - Intergenic
1176571144 21:8413594-8413616 TTGAAGTCGAGGAGCTTATCGGG - Intergenic
1176571541 21:8417958-8417980 TTGAAGTCGAGGAGCTTATCGGG - Intergenic
1176579058 21:8458156-8458178 TTGAAGTCGAGGAGCTTATCGGG - Intergenic
1176579453 21:8462521-8462543 TTGAAGTCGAGGAGCTTATCGGG - Intergenic
1178440454 21:32593978-32594000 CTGAAGACAAGTAGCTGACCTGG + Intronic
1179089489 21:38251426-38251448 CTGAAGCCATGCTGCTGATAGGG + Intronic
1180340893 22:11617846-11617868 TTTAAGTCGAGGAGCTGATCAGG - Intergenic
1181396935 22:22629527-22629549 CCTAAATCAAGCAGCTGATGAGG - Intergenic
1181499682 22:23308886-23308908 CCTAAATCAAGCAGCTGATGAGG - Intronic
1184049756 22:41995741-41995763 CTGTAGTCAAGCACCTGAACAGG + Intronic
1184092063 22:42298104-42298126 CCAAAGTCACACAGCTGATCAGG + Intronic
1184504933 22:44894892-44894914 CTGAGGTCACACAGCTCATCCGG - Intronic
1203257245 22_KI270733v1_random:147792-147814 TTGAAGTCGAGGAGCTTATCGGG - Intergenic
1203257622 22_KI270733v1_random:151957-151979 TTGAAGTCGAGGAGCTTATCGGG - Intergenic
949422176 3:3877775-3877797 CTGGAGACAAGCAAATGATCAGG + Intronic
951367467 3:21801666-21801688 CTAAACTCACGCAGCTGATATGG + Intronic
953627944 3:44586135-44586157 CTGAACTCAAGGAGGAGATCAGG + Exonic
954530342 3:51313356-51313378 CTGGTGTCAAGTATCTGATCTGG - Intronic
955412972 3:58667773-58667795 ATGAGGTCCAGCAGCTGGTCAGG + Intergenic
955894808 3:63687803-63687825 CTTTAGTTAAGCAGCTGCTCTGG + Intergenic
956576464 3:70757809-70757831 CTGAAGCCAAGCTCCTGAGCAGG - Intergenic
964404504 3:156334947-156334969 CTGGAGTCAAGGAAATGATCAGG - Intronic
964614037 3:158643369-158643391 GTGAAGTCAAGCACCTGAACCGG + Intergenic
965692980 3:171377381-171377403 CTTGAGTGAAGCAGCTGAGCGGG - Intronic
966166111 3:177018072-177018094 CTTAGGCCAAGCAGCTGGTCTGG + Intergenic
967001727 3:185342153-185342175 TTGCAGTCAAGCAGTTGACCAGG - Intronic
969878591 4:10154759-10154781 CTGAAGTCAAGCAGTTGTCAGGG - Intergenic
971637146 4:29075518-29075540 CTGAAATCCAGCAGCTGGCCTGG + Intergenic
972619251 4:40731062-40731084 CTGGATTCAAGCATCTGATATGG - Intergenic
974370069 4:61004730-61004752 CTGAAGTCACACAGCTAATAGGG - Intergenic
974382765 4:61162483-61162505 CTGAAGTCCAGAAGCTTTTCTGG - Intergenic
975653213 4:76615025-76615047 CTGAGATCAAGGAGCTTATCAGG + Intronic
977356585 4:95954075-95954097 CTGAGGTCAGGATGCTGATCAGG + Intergenic
979034325 4:115693778-115693800 GTGGAGTCAAGCACATGATCTGG + Intergenic
984851172 4:184153702-184153724 GTGAAGTCCATCAGATGATCGGG - Exonic
986847904 5:11777450-11777472 CTGAAGTTAAGCAGATGAATGGG - Intronic
986897688 5:12390130-12390152 AAGGAGTCAAGCAGCTGGTCTGG + Intergenic
987243234 5:16022508-16022530 TTGGAGTCAATCAGCTGATGAGG + Intergenic
987852314 5:23372391-23372413 ATGAAGACCAGCAGCTGATCAGG + Intergenic
988084882 5:26462241-26462263 AAGAAGTTAAGCAGCTGGTCTGG - Intergenic
989101083 5:37823727-37823749 CCAAGGTCACGCAGCTGATCAGG - Intronic
997757989 5:136418495-136418517 CTCAAGTCAAGCTGTTGACCGGG + Intergenic
997777307 5:136622152-136622174 CTGAAGACAAGAACATGATCAGG - Intergenic
997882169 5:137601049-137601071 CTGAATTCAAGCATTTGATAAGG - Intergenic
999083400 5:148865516-148865538 CTGGAGTCCAGCATCTGATTGGG + Intergenic
1001317987 5:170657851-170657873 CTGGAGTCCAGCAGCAGGTCTGG - Intronic
1001454807 5:171852454-171852476 TTCAAGTCATGGAGCTGATCAGG + Intergenic
1007708028 6:43803327-43803349 CTGAAGTCACCCAGATAATCAGG - Intergenic
1008258300 6:49332406-49332428 TTCCAGTCAAGCTGCTGATCAGG - Intergenic
1008709710 6:54210171-54210193 CTGCAGACAAGCAGCTGCTCTGG - Intronic
1010030755 6:71268509-71268531 CTGAAATCACCCATCTGATCTGG + Intergenic
1010516857 6:76784042-76784064 CTGGAATCAAGGAGATGATCTGG - Intergenic
1011806150 6:91074829-91074851 CTGAAGTCTACCAGCTCCTCGGG - Intergenic
1013290820 6:108717419-108717441 CCGAAGTCCAGCAGCTGCCCCGG - Intergenic
1015394026 6:132715344-132715366 CTGCAGTCAAGCAGCTGCCAGGG + Intergenic
1017622546 6:156314252-156314274 GTGAAGTCAAACAGCTGAGTTGG + Intergenic
1018630769 6:165820353-165820375 CTGAAGTGATCCTGCTGATCTGG - Intronic
1018824568 6:167399308-167399330 CCGAAGACAAGTAGCTGACCTGG + Intergenic
1019764232 7:2837934-2837956 CTGAAGTAAACCACCTGATGTGG + Intronic
1022171510 7:27836432-27836454 CTGAAGTCCAGATGCTGAGCTGG + Intronic
1022525430 7:31034083-31034105 TTGAAGGCAAGCTGCTGATGGGG - Intergenic
1023029636 7:36080978-36081000 CTGAAATCAGGAACCTGATCGGG + Intronic
1023253245 7:38287607-38287629 CTGAAGTCACACAGCTAATATGG + Intergenic
1023484757 7:40674296-40674318 CTGAAGTGAAGCATCAGATTTGG - Intronic
1023623700 7:42096401-42096423 GTCAAGTAAAGCACCTGATCTGG + Intronic
1024239495 7:47423389-47423411 CTGAGGTCAAGAACCTGAGCAGG - Intronic
1026676448 7:72432457-72432479 ATGAAAGCAAGCAGCTGCTCAGG - Intronic
1027427595 7:78077037-78077059 CTACAGACAAGCAGCTGATGTGG + Intronic
1028906778 7:96163314-96163336 GAGAAGTCAAGCAGGTGCTCTGG + Intronic
1028932528 7:96428968-96428990 CTAAAGTCAATCAGCTGAAATGG + Intergenic
1029711470 7:102302342-102302364 CTGGAGTCTGGCAGCTGAGCTGG - Intronic
1030820872 7:114088455-114088477 CTGTTGTCAAGCAGCTGAAGTGG + Intronic
1033537413 7:142324470-142324492 CTGAAGGAAAGCAGCTGTTCCGG + Intergenic
1036205001 8:6799090-6799112 CTGAAGTCACACACCTGGTCAGG + Intergenic
1037220794 8:16518011-16518033 ATGAAGTCAAGAACCTGAACCGG - Intronic
1039928041 8:41957035-41957057 CTGAAGTCATGCACCTGCTGCGG + Intronic
1041207128 8:55510652-55510674 CTGAGATCAAGCTGCTGCTCCGG + Intronic
1042655708 8:71093211-71093233 CTGAAATCAAGCAGCTAGTTAGG + Intergenic
1046516437 8:115267854-115267876 CTGTAGTCAAGCTGCTGGCCCGG - Intergenic
1048731886 8:137451331-137451353 TTAAAGTCACGCAGCTGATGTGG - Intergenic
1053081503 9:35181785-35181807 CTGAAGTGCAGTGGCTGATCTGG - Intronic
1055591088 9:77814660-77814682 GTGATGTCAAGCAGCCTATCAGG + Intronic
1058189056 9:101891081-101891103 CTGAACTCAAGCAAGTGTTCGGG - Intergenic
1058668014 9:107338002-107338024 CTGAGGTCACCCAGCTGATGTGG - Intergenic
1058684357 9:107467108-107467130 CTGAAGCCAAGGGGCTGCTCTGG - Intergenic
1059599582 9:115762192-115762214 CAGAAGTCAAGCAGCACCTCTGG - Intergenic
1060872388 9:127053208-127053230 CAGAAGTCATGCCGCTGACCCGG - Intronic
1061414609 9:130439705-130439727 CTTATGACAAGCAACTGATCTGG + Intergenic
1061689982 9:132319509-132319531 CCGAAGTGAAGTAGCTGATAAGG - Intronic
1203473419 Un_GL000220v1:129614-129636 TTGAAGTCGAGGAGCTTATCGGG - Intergenic
1203473814 Un_GL000220v1:133979-134001 TTGAAGTCGAGGAGCTTATCGGG - Intergenic
1192140528 X:68644074-68644096 GAGAAATCAAGCAGCTGATCAGG + Intergenic
1199049887 X:143224680-143224702 CTGAAGTTCAGAGGCTGATCTGG + Intergenic