ID: 925990423

View in Genome Browser
Species Human (GRCh38)
Location 2:9250187-9250209
Sequence ACACGCTGCCTGACACAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 1, 2: 2, 3: 16, 4: 192}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925990422_925990423 -1 Left 925990422 2:9250165-9250187 CCAGGATCATTTTTAGCATTTAA 0: 1
1: 0
2: 4
3: 35
4: 622
Right 925990423 2:9250187-9250209 ACACGCTGCCTGACACAAAGTGG 0: 1
1: 1
2: 2
3: 16
4: 192
925990419_925990423 26 Left 925990419 2:9250138-9250160 CCATGATCTCCTTGGGGGCAGAA 0: 1
1: 0
2: 3
3: 32
4: 307
Right 925990423 2:9250187-9250209 ACACGCTGCCTGACACAAAGTGG 0: 1
1: 1
2: 2
3: 16
4: 192
925990418_925990423 27 Left 925990418 2:9250137-9250159 CCCATGATCTCCTTGGGGGCAGA 0: 1
1: 0
2: 4
3: 22
4: 178
Right 925990423 2:9250187-9250209 ACACGCTGCCTGACACAAAGTGG 0: 1
1: 1
2: 2
3: 16
4: 192
925990420_925990423 17 Left 925990420 2:9250147-9250169 CCTTGGGGGCAGAAACTGCCAGG 0: 1
1: 0
2: 0
3: 32
4: 285
Right 925990423 2:9250187-9250209 ACACGCTGCCTGACACAAAGTGG 0: 1
1: 1
2: 2
3: 16
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925990423 Original CRISPR ACACGCTGCCTGACACAAAG TGG Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
901663207 1:10811938-10811960 ACACAGTGCCTGGCACATAGTGG + Intergenic
903082845 1:20825766-20825788 CCATGCTGCCTGATACAAGGAGG + Intronic
904613382 1:31737138-31737160 ACACGCTCACAGACACAAGGAGG + Intronic
905696776 1:39980477-39980499 ACACAATGCCTAGCACAAAGTGG + Intergenic
907110239 1:51920470-51920492 ACCCTGTGCCTGACACAGAGGGG + Intronic
907383847 1:54112826-54112848 TCACCCTGCCTCCCACAAAGAGG + Intergenic
907395210 1:54184982-54185004 ACATGGTGCCTGGCACAGAGTGG - Intronic
907447379 1:54517329-54517351 ACACAGTGCTTGGCACAAAGTGG + Intergenic
908157886 1:61375002-61375024 ACAGGCTGCGTGATACAAGGAGG - Intronic
913329715 1:117657106-117657128 ACACGATGCCTGTCACATGGCGG - Intergenic
914141343 1:144951602-144951624 ACACGATACCTGGCACATAGAGG + Intronic
914748583 1:150516808-150516830 GCACTCTGCCTAACACAAAAAGG - Intergenic
915135290 1:153727652-153727674 ACACGAAGCCTGCCACGAAGTGG - Intergenic
915274294 1:154777318-154777340 AGACGTTGCCTGGCACAGAGTGG + Intronic
915634127 1:157174490-157174512 ACACTCTGCCAGTCACAAACAGG - Intergenic
916324655 1:163543285-163543307 ACACAGTGCCTGACACATACGGG - Intergenic
917928833 1:179810078-179810100 ACACCATGCCTGACACATACCGG - Intronic
919121307 1:193343798-193343820 CCATGCTGCATGACACATAGTGG + Intergenic
919547146 1:198938164-198938186 ACATTCTGCCTTACATAAAGTGG - Intergenic
919918154 1:202151902-202151924 ACACCGTGCCTGACAAAAATAGG + Intronic
920442774 1:205992412-205992434 ACACTGTGCCTGGCACATAGTGG + Intronic
921826665 1:219679656-219679678 ACACACAGACAGACACAAAGAGG + Intergenic
922765439 1:228154196-228154218 ACACGGTGACTGACACCATGTGG - Intronic
923696071 1:236253807-236253829 ACCCAGTGCCTGACACATAGTGG - Intronic
924509868 1:244721191-244721213 TCACCCAGCCTGACACACAGTGG + Intergenic
1065353541 10:24817039-24817061 ACATCCTGCCTGACACATAATGG + Intergenic
1068761466 10:60715317-60715339 ACAAAATGCCTGGCACAAAGAGG + Intronic
1071100944 10:82037079-82037101 ATACCCTGCCTGACTCAGAGGGG - Intronic
1071225094 10:83519781-83519803 ATATCCTGCATGACACAAAGGGG + Intergenic
1071549858 10:86558306-86558328 CCATGCTGCCTGACAAAAATGGG + Intergenic
1072085409 10:92074325-92074347 ACACAATGCCTGACACCTAGTGG - Intronic
1072224649 10:93357453-93357475 ACACGATCCCTGTCACACAGTGG - Intronic
1072320529 10:94245329-94245351 ACACGGTTCCTGACACAAGAAGG + Intronic
1072807721 10:98435207-98435229 ACACGCTGCCTGGCCCAGCGAGG + Intronic
1073767195 10:106695648-106695670 ACACCATGCCTGGCATAAAGTGG + Intronic
1075219213 10:120569812-120569834 ACACACTGCCTGACAATAGGAGG - Intronic
1075684303 10:124353280-124353302 AGAAGCTGCCTGACCCAAGGAGG - Intergenic
1075960762 10:126566316-126566338 GCACAGTGCCTGACACATAGGGG - Intronic
1080818983 11:35787247-35787269 ACACGCTGGCTGACCCAAGGTGG - Intronic
1081866727 11:46364346-46364368 GCACAGTGCCTGACACATAGGGG + Intronic
1083167978 11:60903207-60903229 GCACAGTGCCTGACACAACGAGG - Intronic
1084450092 11:69231678-69231700 ACACCATGCCTGACACATTGGGG - Intergenic
1085273835 11:75285706-75285728 ACAAGGGGCCTGGCACAAAGGGG + Intronic
1085732642 11:79012521-79012543 TCTCACTGTCTGACACAAAGTGG + Intronic
1086452978 11:86935275-86935297 GCACAAAGCCTGACACAAAGTGG - Intronic
1088298692 11:108330477-108330499 ACACGATTCCTGACATCAAGGGG - Intronic
1088484614 11:110328696-110328718 ACACCCTGCCTGATCCAGAGTGG + Intergenic
1090117718 11:123992524-123992546 AAACACTCCCTGGCACAAAGGGG - Intergenic
1090598371 11:128343503-128343525 ACACGATGCTTGGCACAGAGTGG - Intergenic
1090945807 11:131428569-131428591 ACACACAGTGTGACACAAAGAGG - Intronic
1094244227 12:28269273-28269295 CCACTCCGCCTGCCACAAAGAGG - Intronic
1097333824 12:58360155-58360177 CCACGCAGCCTGCCACAATGTGG + Intergenic
1101010089 12:100440503-100440525 AAAAGGTGCCTGACACATAGTGG + Intergenic
1102312935 12:111861290-111861312 AAAAACTACCTGACACAAAGGGG - Intronic
1102710948 12:114926240-114926262 AGAGGCTGCCTGCCACATAGGGG - Intergenic
1104285567 12:127421431-127421453 ACACAATGCCTGAAGCAAAGAGG + Intergenic
1104295635 12:127509661-127509683 ACATGTTTGCTGACACAAAGAGG - Intergenic
1104939961 12:132390420-132390442 CCACGCTCCCTGGCACAAAAGGG + Intergenic
1105283409 13:18983521-18983543 GCACAGTGCCTGACACAGAGTGG - Intergenic
1106259082 13:28049041-28049063 ACACAGAGCCTGACACAAAATGG - Intronic
1112315547 13:98359283-98359305 ACCCACTGCCTGGCACACAGTGG + Intronic
1112339673 13:98542904-98542926 ACACGCGGCCTGACAGGAACGGG + Intronic
1112487316 13:99831748-99831770 ACACGCTACCAGAAAAAAAGGGG + Intronic
1112676011 13:101703027-101703049 ACACAATGCCTGAGACACAGTGG - Intronic
1113129406 13:107018834-107018856 ACACGTGGCATGACACAGAGTGG + Intergenic
1117018075 14:51539442-51539464 ACATAGTGCCTGACACATAGTGG + Intronic
1120075011 14:80146176-80146198 ACACCATGCCTGACACCAGGTGG - Intergenic
1122750910 14:103932269-103932291 GCACGGTGCCTGGCACATAGTGG + Intronic
1125350454 15:38761717-38761739 GCACAGTGCCTGACACATAGTGG - Intergenic
1125968878 15:43895942-43895964 ACAAGTTGCATGACAAAAAGAGG + Intronic
1128866620 15:71119443-71119465 ACATGCTGCCTGGGATAAAGTGG - Intronic
1129423678 15:75450625-75450647 ACACGCTGCATGGAGCAAAGCGG + Intronic
1131636299 15:94236415-94236437 TCACGCTGCTTGACACCATGGGG - Intronic
1131859919 15:96641762-96641784 ACACCCTTCCTGACACATACAGG - Intergenic
1131863117 15:96675807-96675829 AAACTGTGCCTGACACAGAGTGG - Intergenic
1134216490 16:12320629-12320651 ACACACTGCCTGGAACACAGTGG - Intronic
1138541347 16:57689588-57689610 ACAGACAGGCTGACACAAAGAGG + Intergenic
1139657325 16:68396946-68396968 ACACAGTGCCTGGCACACAGTGG - Intronic
1140335114 16:74097816-74097838 ACCCGCTGCCTTCCCCAAAGTGG + Intergenic
1140941555 16:79726020-79726042 ACCCACTGCCTGATACACAGAGG - Intergenic
1144209587 17:13003111-13003133 ACACACTGCCTCCCACAAAGTGG + Intronic
1144803030 17:17944198-17944220 TCATGGTGCCTGGCACAAAGTGG + Intronic
1145845289 17:28033204-28033226 GCACAATGCCTGACACAGAGTGG - Intergenic
1146212437 17:30952981-30953003 ACATGTTGCCTGACACCAAGAGG + Intronic
1148200091 17:45744382-45744404 ACACACTTCCTGGCACAAGGAGG + Intergenic
1148987681 17:51637852-51637874 ACACTGTGCCTAGCACAAAGAGG - Intronic
1152260418 17:79263709-79263731 GAACGGTGCCTGACACACAGGGG + Intronic
1153886982 18:9475777-9475799 ACACGCTGCCTGACAGACGCGGG - Intronic
1155026258 18:21943523-21943545 ATACATTGCCTGACACACAGCGG + Intergenic
1155318783 18:24597751-24597773 AGAAGCAGCCTGACACAATGGGG + Intergenic
1155327625 18:24681140-24681162 ACTAGTTGCCTGACACAAAACGG - Intergenic
1161882889 19:6969275-6969297 ACACAATGCCTGACACACAGTGG + Intergenic
1165803900 19:38568740-38568762 AGACTCTGCCTCAAACAAAGTGG + Intronic
1166222290 19:41373466-41373488 AAACAGTGCCTGGCACAAAGTGG - Intronic
925990423 2:9250187-9250209 ACACGCTGCCTGACACAAAGTGG + Intronic
926438976 2:12867546-12867568 ACATTGTGCCTGACACATAGTGG + Intergenic
926938141 2:18106694-18106716 TCACCCTGCCTCACACAAAGTGG - Intronic
927483725 2:23474224-23474246 ACATACTGCCTGACACATAGAGG + Intronic
929317477 2:40497320-40497342 ACACAGTGTCTGACACACAGTGG - Intronic
929601313 2:43206457-43206479 ACACCTTGCCTGGCACACAGTGG - Intergenic
930561992 2:52971110-52971132 ACACAATATCTGACACAAAGAGG - Intergenic
932180069 2:69638934-69638956 ATACAGTGCCTGCCACAAAGAGG + Intronic
935274234 2:101462418-101462440 ACACTCTGCCTCAAAAAAAGGGG + Intronic
937259961 2:120578956-120578978 AAAAGGTGCCTGACATAAAGAGG + Intergenic
938228219 2:129635957-129635979 ACACTGTGGCTGACAGAAAGGGG - Intergenic
939127221 2:138192129-138192151 GCATGCTCCCTGACACATAGTGG - Intergenic
940134880 2:150424991-150425013 ACACAGTGCCTGGCACACAGTGG - Intergenic
941990987 2:171556738-171556760 GCCCTCTGCCTGGCACAAAGTGG + Exonic
943745680 2:191460646-191460668 AGACCCTGCCTGACAAAGAGGGG - Intergenic
944660636 2:201918772-201918794 CGAGGCTGCCTGAAACAAAGGGG - Intergenic
946364937 2:219243227-219243249 GCAGGCTGCCAGACACATAGCGG + Exonic
948119718 2:235520423-235520445 GCACGCTGACTGACTCCAAGGGG - Intronic
1169333314 20:4733472-4733494 ACAAGAAGCCTGACAAAAAGCGG - Intronic
1169948019 20:11010301-11010323 AGACTCTGCCTGACACAAGTTGG + Intergenic
1170333030 20:15236510-15236532 ACACAGTGCCTGGCACCAAGTGG - Intronic
1172947205 20:38698794-38698816 ACACCCTGCCTGATCCAGAGGGG - Intergenic
1173163802 20:40671899-40671921 ACACAGTGCCTGGCACAGAGGGG - Intergenic
1173647699 20:44643852-44643874 CCACGGTGCCTGGCACATAGTGG - Intronic
1174787863 20:53449428-53449450 CAACGGTGCCTGACACATAGTGG - Intronic
1176190555 20:63807762-63807784 ACCCGCTGCCTCACACAGACGGG - Intronic
1177984438 21:27955949-27955971 ACACACAGCATGTCACAAAGGGG + Intergenic
1178187630 21:30241670-30241692 ACACACTACCTGCCACACAGTGG - Intergenic
1178754452 21:35335299-35335321 GAACGCTGCCTGACACACAAGGG - Intronic
1181164845 22:20977714-20977736 ACAGGCTTCCTGAGGCAAAGCGG + Exonic
1183260427 22:36791490-36791512 ATACGCTCCCTGGCACAAAGGGG - Intergenic
1183910971 22:41078901-41078923 ACACAGTGCCTGCCACATAGAGG + Intergenic
1184385695 22:44173265-44173287 ACAGGCTGCATGACACATGGAGG + Intronic
952643714 3:35630095-35630117 TCATGCTGCCTGACAAAAATAGG - Intergenic
953131441 3:40143161-40143183 ACACAGTGCCTGGCACATAGTGG + Intronic
953628030 3:44586818-44586840 ACATGGTGTCTGACACAGAGAGG - Intronic
955447527 3:59029873-59029895 ACACGATGCCTGACAATAAGAGG + Intronic
955704456 3:61713718-61713740 ACACGCTGCCTGCCACACACAGG - Intronic
956725499 3:72153302-72153324 AAACGGTGCCTGAGACAAATTGG - Intergenic
961308707 3:125978743-125978765 ACACCCTGGCGGACTCAAAGAGG - Intronic
962167026 3:133060090-133060112 ACACAGTGCCTGGCACAAAAGGG - Intronic
962199128 3:133387195-133387217 ACACAATGCCTGACACACAATGG - Intronic
962741057 3:138362772-138362794 GCACGGTGCCTGCCACACAGTGG - Intronic
963128462 3:141836425-141836447 ACACAGTGCCTGGCACAGAGTGG + Intergenic
963480886 3:145873208-145873230 ACACGCTGCATGATACAATATGG + Intergenic
964714531 3:159708083-159708105 GAACAGTGCCTGACACAAAGTGG + Intronic
965403458 3:168241641-168241663 ACTCTCTGCATGACACACAGAGG + Intergenic
967571352 3:191032468-191032490 ACACCATGCCTGACACATCGAGG - Intergenic
970025888 4:11623618-11623640 GCATGCTGCCTGACACACACTGG + Intergenic
971343965 4:25795688-25795710 ACACGCTGCCTGCCACACCCAGG + Intronic
975242260 4:72074582-72074604 ATACGCTCCCAGACCCAAAGTGG - Intronic
977107058 4:92900161-92900183 AGACTCTGAGTGACACAAAGTGG + Intronic
977182489 4:93894052-93894074 ACAACCTTCCTGTCACAAAGTGG - Intergenic
978084871 4:104638947-104638969 ACATGGTGCCTTATACAAAGTGG + Intergenic
979838044 4:125398412-125398434 AAATGCTGCCTGACAAACAGAGG - Intronic
981639107 4:146915008-146915030 ACACAGTGCCTGACACATTGTGG - Intronic
985012621 4:185599908-185599930 CCAGGATGCCTGCCACAAAGTGG + Intronic
985712486 5:1437300-1437322 ACACCCAGACTGACACAGAGAGG - Intronic
986054840 5:4126714-4126736 CCACTCTTCCTGACACAGAGTGG - Intergenic
992230214 5:74656576-74656598 ACACATTGCATGACACAGAGTGG + Intronic
994389883 5:99179549-99179571 TCACGCCGCCTGGCACAAAGTGG - Intergenic
996836038 5:127793480-127793502 TCAGGCTGCCTGTCACAATGAGG - Intergenic
998132213 5:139657086-139657108 ACATGGTGCCTGCCACAGAGAGG - Intronic
998478652 5:142442895-142442917 ACACAGTGCCTGGCACATAGAGG + Intergenic
999201764 5:149821714-149821736 ACACAGTGCCTGACACATAGGGG - Intronic
999212220 5:149899757-149899779 ACACACTGCCTGACACACACTGG - Intronic
1000171675 5:158708398-158708420 GCACACTGCCTGGCACACAGTGG - Intronic
1003168104 6:3699057-3699079 ACTTGCTGCCTGACACACATGGG + Intergenic
1003732181 6:8837288-8837310 ACTCGCTGCCTAACACGAATTGG - Intergenic
1004991312 6:21141503-21141525 ACTCAGTGCCTGACACATAGTGG + Intronic
1006119556 6:31795722-31795744 AAACGCTCCCTGTCACAAAGGGG - Exonic
1009351415 6:62684206-62684228 ACACCCTGCCAGATCCAAAGTGG + Intergenic
1009644836 6:66386721-66386743 AAACGCTGCCTGAGACATAGGGG - Intergenic
1009835162 6:68991099-68991121 ACACACTACCTGACTTAAAGAGG - Intronic
1011719965 6:90145148-90145170 GCATACTGCCTGACACATAGTGG + Intronic
1012949457 6:105502804-105502826 ACACAGTGCCTGCCACAGAGTGG - Intergenic
1017919518 6:158859073-158859095 ACACACTGCCTGGCACAAAGTGG + Intergenic
1017943292 6:159072578-159072600 GCACAGTGCCTGACACATAGTGG - Intergenic
1019032928 6:169028586-169028608 ACACGCTGTATGACACTAACAGG + Intergenic
1019093753 6:169562612-169562634 TCACGCAGCCTGGCACAGAGTGG - Intronic
1019402062 7:860945-860967 ACCCGCTCCCTGCCACAATGTGG + Intronic
1027889779 7:83957015-83957037 GCATGATGCCTGGCACAAAGAGG - Exonic
1032725350 7:134585847-134585869 ACACCCTGCCTGATCCAGAGAGG - Intergenic
1033046037 7:137962809-137962831 ACACAGTACCTGGCACAAAGTGG + Intronic
1034260579 7:149752872-149752894 ACACCCTCCCTTACACCAAGCGG - Intergenic
1036071542 8:5445763-5445785 ACACACTGGCTGACATAAAGGGG + Intergenic
1037761312 8:21743591-21743613 ACACAATGCCTGGCCCAAAGTGG + Intronic
1038110249 8:24488742-24488764 ACACAGTACCTGGCACAAAGTGG - Intronic
1038170609 8:25128363-25128385 CCACGCTGCCGGACACAGCGTGG - Intergenic
1041388868 8:57331483-57331505 ACATGCTGACTGACACAAAGTGG - Intergenic
1043441800 8:80282945-80282967 ACACTCTCCCTGACACATGGTGG - Intergenic
1044658860 8:94576050-94576072 ACAGCCTGGCTGACACAATGAGG - Intergenic
1048026417 8:130591332-130591354 CCATAGTGCCTGACACAAAGTGG + Intergenic
1048793418 8:138125834-138125856 ACACGCTGCCTGACACAGAGTGG - Intergenic
1049232616 8:141492356-141492378 ACCCGCTGCCTGGGACACAGAGG - Intergenic
1050094562 9:2050584-2050606 GCCTGCTTCCTGACACAAAGAGG - Intronic
1055558361 9:77498593-77498615 ACATGATGCCTGGCACACAGTGG + Intronic
1057276987 9:93681213-93681235 ACAGGCTGCCTGGCACTCAGTGG - Intergenic
1057866802 9:98687809-98687831 ACACAGTGCCTGGCACACAGAGG + Intronic
1058372341 9:104284434-104284456 AAACACTGCCTGGCACATAGTGG + Intergenic
1058720460 9:107759442-107759464 ACACAATGCCTGCCACAGAGAGG - Intergenic
1058791432 9:108449742-108449764 ACAAGCTGTCTGACACAGGGTGG + Intergenic
1061745901 9:132740207-132740229 ACACAGTGCCTGATAAAAAGTGG - Intronic
1062109485 9:134774155-134774177 ACAGGATGCCTGGCACATAGAGG - Intronic
1062386230 9:136312579-136312601 ACAGGCTGCCTGTCCCTAAGGGG - Intergenic
1186191700 X:7073104-7073126 GCACCCTGCCTGGCACACAGTGG + Intronic
1186912471 X:14183392-14183414 CCACAATGCCTGACACAAATAGG - Intergenic
1187237657 X:17483553-17483575 GCACAATGCCTGACACAAACAGG - Intronic
1195323259 X:103738104-103738126 ACATGATGCCTGACATAGAGGGG - Intergenic
1195430794 X:104787090-104787112 AAACGTTGCCTGGCACAAAGTGG - Intronic
1196866354 X:120074576-120074598 AAAAGCTGCCTGACAAAACGGGG - Intronic
1196876744 X:120161705-120161727 AAAAGCTGCCTGACAAAACGGGG + Intronic
1197916707 X:131543519-131543541 CCACGGTGCCTGACATAGAGTGG - Intergenic
1197971805 X:132122180-132122202 ATAAGGTTCCTGACACAAAGCGG - Intronic
1198122419 X:133607322-133607344 GCACAATGCCTGACACATAGTGG + Intronic
1198405115 X:136304684-136304706 GCATGCTGCCTGGCACATAGAGG - Intronic
1201268173 Y:12228970-12228992 TCACCATGCCTGACACACAGTGG - Intergenic