ID: 925990557

View in Genome Browser
Species Human (GRCh38)
Location 2:9250999-9251021
Sequence CCACCCAAATGCCACCTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 1, 2: 3, 3: 38, 4: 312}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925990557_925990560 7 Left 925990557 2:9250999-9251021 CCAAGGAGGTGGCATTTGGGTGG 0: 1
1: 1
2: 3
3: 38
4: 312
Right 925990560 2:9251029-9251051 AAGGTCTGTAGAGTTTGAATTGG 0: 1
1: 0
2: 0
3: 7
4: 137
925990557_925990561 21 Left 925990557 2:9250999-9251021 CCAAGGAGGTGGCATTTGGGTGG 0: 1
1: 1
2: 3
3: 38
4: 312
Right 925990561 2:9251043-9251065 TTGAATTGGAGACAGATTAGAGG 0: 1
1: 0
2: 1
3: 25
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925990557 Original CRISPR CCACCCAAATGCCACCTCCT TGG (reversed) Intronic
900287220 1:1907473-1907495 CCACCCAAATCCCTGCTGCTTGG - Intergenic
900394968 1:2449639-2449661 CCACCCCAGTGACACCACCTGGG - Intronic
901130602 1:6960525-6960547 CAGCTCAAATGTCACCTCCTCGG + Intronic
901168115 1:7234306-7234328 CCACCCAGATGCTGCGTCCTGGG + Intronic
901659588 1:10790057-10790079 CCACGCAGATGCCACCGCCCAGG + Intronic
902122503 1:14178980-14179002 CCACCCAAATTCCTCCTCTTTGG + Intergenic
902245887 1:15120134-15120156 CTACCCTAGTGCCACCTCATGGG - Intergenic
902247210 1:15128851-15128873 CCCCCCAAAAGCCACCTTTTGGG - Intergenic
903354437 1:22737569-22737591 CAACTCAAATGTCCCCTCCTTGG + Intronic
904296440 1:29522362-29522384 CCACCCAGCTTCCTCCTCCTAGG + Intergenic
904352835 1:29920162-29920184 ACATCCAAATACCATCTCCTTGG - Intergenic
904483347 1:30807554-30807576 CCACTCAAATATCACCTCCCCGG + Intergenic
904508839 1:30984373-30984395 TCACACAAATGCCATCTGCTGGG + Intronic
904748804 1:32727887-32727909 CCTCCCAACTCCTACCTCCTGGG + Intergenic
905030000 1:34875879-34875901 CCACCCAAATGTCACTTCCCAGG + Intronic
905334610 1:37235884-37235906 CCTTCCAAATGCCACCACTTTGG - Intergenic
905436838 1:37962007-37962029 TCACCCAACCTCCACCTCCTGGG - Intronic
905847744 1:41246861-41246883 CCACTCAAATGTCACCTTCTTGG - Intergenic
906000717 1:42422151-42422173 CAACACAAATGCTACCTCCCTGG - Exonic
907409626 1:54274964-54274986 CAGCCCAAATGTCACCCCCTCGG + Intronic
909248892 1:73327113-73327135 CCACCCCAATACCACTTCCACGG - Intergenic
909388028 1:75082740-75082762 CAACCAAAATGCCACCGCCAAGG + Intergenic
909718154 1:78735457-78735479 CTGCCCAAATGTCACCTCTTTGG - Intergenic
910803836 1:91170938-91170960 CCACCCCAATGCCATCTCTAAGG - Intergenic
911045969 1:93628605-93628627 CCACTCAAAAGTCACCTTCTTGG + Intronic
912558661 1:110534614-110534636 CAGCTCAAATGCCACATCCTGGG - Intergenic
912730407 1:112097449-112097471 CCACCCATATGCCCCATTCTTGG - Intergenic
914454185 1:147820326-147820348 CCACCCAAATGCCATATTTTAGG + Intergenic
916548113 1:165825952-165825974 TCACCCAAATGCCTGCTTCTGGG + Intronic
917488097 1:175473616-175473638 CCACCCAAATCCCATGTCCAAGG - Intronic
917559470 1:176132293-176132315 CAACTTAAATGTCACCTCCTTGG + Intronic
919741499 1:200983888-200983910 CCACAGAAATGCCCCTTCCTGGG - Intronic
920294289 1:204946483-204946505 CCACACACATGGCACCTCCCCGG + Intronic
921764944 1:218960435-218960457 CCATTCAAATGTCACATCCTAGG - Intergenic
921851131 1:219933211-219933233 TCACCCAAACGCCACCTCCATGG + Intronic
923750488 1:236742089-236742111 CAGCTCAAATGCCCCCTCCTCGG + Intronic
924277327 1:242401687-242401709 CTGCTCAAATGTCACCTCCTCGG + Intronic
1062944216 10:1448459-1448481 CTGCCCAAATCCCTCCTCCTTGG + Intronic
1063739632 10:8803985-8804007 CCAGCCACATGCCACCTTCCAGG - Intergenic
1068378501 10:56215448-56215470 CCAGCCAAATGCCTCATCCTAGG + Intergenic
1069671489 10:70208625-70208647 CCAGACAAATGCCAACTCTTAGG + Intronic
1070310937 10:75273315-75273337 CCAGCCCAATCCAACCTCCTGGG - Intergenic
1070678759 10:78434224-78434246 CCAAGCACATGCCACCCCCTCGG - Intergenic
1072276872 10:93832396-93832418 CCACCAAAATGCAAGCTCCAAGG - Intergenic
1073282057 10:102361685-102361707 CCACCCAAATGGCAATTACTGGG + Intronic
1073727386 10:106249067-106249089 CCTGCCAAATGCCACAGCCTTGG + Intergenic
1074873457 10:117595796-117595818 CCCTTCAAATGCCATCTCCTTGG - Intergenic
1077996042 11:7453511-7453533 CCACCAGAATGCAACCTCCACGG - Intronic
1078628341 11:12979058-12979080 ACACCTAAATGCCCCCTGCTAGG + Intergenic
1079169121 11:18075389-18075411 AGACCCTGATGCCACCTCCTTGG + Intronic
1079350260 11:19686100-19686122 CCACCCCAGGGCCTCCTCCTTGG + Intronic
1079522663 11:21347165-21347187 CCACTCAAATGTCAACTCCTCGG - Intronic
1080277914 11:30523851-30523873 CTGCTCAAATGCCACCTCTTTGG - Intronic
1080703388 11:34665430-34665452 CCACCAAAAAGCCACATCCTTGG - Intergenic
1081670259 11:44938649-44938671 AGACCCAAATGCCCTCTCCTGGG - Intronic
1082893269 11:58163164-58163186 CAGCTCAAATGCCACTTCCTTGG + Intronic
1083292917 11:61699787-61699809 CCACCCGAATGCCACCCCATAGG + Intronic
1083611679 11:64007379-64007401 CTGCTCCAATGCCACCTCCTCGG - Intronic
1083624850 11:64067193-64067215 CCTCCCATCTGCCATCTCCTTGG - Intronic
1084725862 11:70941536-70941558 CAATCCAAATGCCATCCCCTTGG - Intronic
1085285096 11:75354468-75354490 CAGCCCAAAGCCCACCTCCTCGG - Intergenic
1085522631 11:77147271-77147293 CAGCTCATATGCCACCTCCTCGG + Intronic
1085709691 11:78817905-78817927 CAGTTCAAATGCCACCTCCTTGG + Intronic
1085750007 11:79153586-79153608 CCACCATCATGCCACCTTCTAGG - Intronic
1089385972 11:118068304-118068326 CAATCCAAATGCTCCCTCCTCGG + Intergenic
1090158233 11:124464166-124464188 CCACACAGGTGCCACCTCCAGGG + Intergenic
1092061371 12:5553663-5553685 CCACCACCATGCCACCTACTAGG - Intronic
1092064664 12:5579887-5579909 TCACTCAAATGCCACCTCCTTGG + Intronic
1092259971 12:6947769-6947791 CAGCTCAAATGTCACCTCCTCGG - Intronic
1092589141 12:9934425-9934447 TCACGCAACTTCCACCTCCTGGG + Intergenic
1092747222 12:11685015-11685037 TCACACTCATGCCACCTCCTAGG - Intronic
1094148735 12:27258402-27258424 GCAACTAACTGCCACCTCCTGGG + Intronic
1096647238 12:53045549-53045571 CCTCCCAAATGCCAATTTCTGGG + Intergenic
1099679521 12:85807120-85807142 CTATTCAAATGTCACCTCCTTGG - Intronic
1099853009 12:88127410-88127432 CACTGCAAATGCCACCTCCTGGG - Intronic
1101217690 12:102601162-102601184 CCCCCAAAATACCAACTCCTGGG + Intergenic
1101736462 12:107466842-107466864 CCACTCAAATGCTTCTTCCTCGG - Intronic
1102583393 12:113906710-113906732 CCACGCAAATGTCCCCTGCTTGG + Intronic
1103303017 12:119942557-119942579 CCACCCACATGCCCCCTCAAGGG + Intergenic
1103570031 12:121838890-121838912 GCTCCCAAATGTCACCTTCTCGG + Intergenic
1103888071 12:124217547-124217569 CCACCCACAGCTCACCTCCTCGG + Intronic
1104328869 12:127825746-127825768 CCATCCTAATACCATCTCCTTGG - Intergenic
1105278373 13:18949143-18949165 CCTCACCAATGCCACCTCCCGGG + Intergenic
1106399020 13:29409866-29409888 CAACCTAAATGCCCCTTCCTAGG - Intronic
1106774974 13:32999992-33000014 GCAGCCGAATGCCACTTCCTAGG - Intergenic
1106892151 13:34257214-34257236 CCCCACAACTTCCACCTCCTGGG - Intergenic
1106998915 13:35521714-35521736 CCAACCAAATTCCCTCTCCTTGG - Intronic
1107720891 13:43246804-43246826 CCACCTTATTGCCACATCCTTGG - Intronic
1107740322 13:43443746-43443768 CAGCTCAAATGTCACCTCCTCGG - Intronic
1108199872 13:48032440-48032462 ACACACAACTTCCACCTCCTGGG + Intergenic
1108516092 13:51204313-51204335 TGACCCAAATGCCTCCTACTAGG - Intergenic
1110278220 13:73662323-73662345 TCTCCCAAATCCCACATCCTGGG - Intergenic
1110442285 13:75538877-75538899 CCACCCAAACCCCACCACCCCGG - Intronic
1110551927 13:76820387-76820409 TGACCCAAATGCCTCCCCCTAGG + Intergenic
1113767066 13:112888310-112888332 CCACCCTAGTGCCGCCCCCTGGG - Intergenic
1113781811 13:112981550-112981572 CCACCCAGATGCCACGGGCTCGG - Intronic
1117376833 14:55125054-55125076 CAGCTCAAATACCACCTCCTTGG + Intronic
1117725553 14:58669464-58669486 CCATGCAAATGCCACCTCAAGGG - Intergenic
1119137982 14:72238291-72238313 CCACCCAAATGTTACCTTTTTGG - Intronic
1119252376 14:73168008-73168030 CCACCCAAATGTTGCCTCTTTGG + Intronic
1122664503 14:103319249-103319271 CCACCCACCTGCCCCCTCCCGGG + Intergenic
1122724205 14:103739823-103739845 CCACCCTCCTGCCACCTCCACGG - Exonic
1122885942 14:104710336-104710358 CCACCCTGCTGCCACCACCTCGG + Intronic
1124656155 15:31509352-31509374 CACCGCAAATTCCACCTCCTGGG + Intronic
1128789166 15:70420278-70420300 GCTCCCTAATGCCTCCTCCTAGG + Intergenic
1129453865 15:75665885-75665907 CTACATAAATGTCACCTCCTTGG + Intergenic
1129829881 15:78661714-78661736 CCACCCCACTCCCACCTCCACGG - Intronic
1130206540 15:81880670-81880692 CCACCCTCCTGCCACCTCCGTGG - Intergenic
1131488867 15:92844622-92844644 CCTCCCAAACTCCACCTCCCGGG + Intergenic
1132493855 16:250426-250448 CCACCCCCATGCCAGCTGCTTGG + Intronic
1132769013 16:1550745-1550767 CCTGCCAAATGCCACCCTCTGGG + Intronic
1132917705 16:2361924-2361946 CCCCCCAACTACCACCTCATAGG - Intergenic
1133592302 16:7257322-7257344 CCACCCAAAGGTCACCACCTGGG + Intronic
1134779689 16:16884554-16884576 CCAGCCAAATGGCACCACCTGGG - Intergenic
1135413900 16:22254497-22254519 CCTCCTCAATGCCACCTCCTGGG - Intronic
1136551092 16:30983013-30983035 CCAGCCAAAAGCCACCTCAGTGG - Intronic
1139812922 16:69637667-69637689 TGACTCAAATACCACCTCCTGGG + Intronic
1139851367 16:69952887-69952909 CCACCCCACCCCCACCTCCTGGG - Intronic
1139880344 16:70175799-70175821 CCACCCCACCCCCACCTCCTGGG - Intronic
1140372166 16:74419718-74419740 CCACCCCACCCCCACCTCCTGGG + Intronic
1141094797 16:81155392-81155414 TCACGCAACTTCCACCTCCTGGG - Intergenic
1141649953 16:85387512-85387534 TCACTCAAATGTCACCTCATTGG + Intergenic
1142520111 17:498578-498600 CCTCCCAGGTGCCACCACCTTGG - Intergenic
1142749866 17:1980850-1980872 ACACCGCACTGCCACCTCCTGGG - Intronic
1143948082 17:10611665-10611687 CCAGACAAATACCAGCTCCTAGG - Intergenic
1143982103 17:10879091-10879113 CTACCCAAATGTCAGCTACTGGG - Intergenic
1144769406 17:17751234-17751256 CCGACCAAATGTCACCTCCTCGG - Intronic
1144846897 17:18224902-18224924 AGTCCCAAATGCCACCTCCTGGG + Intergenic
1146176350 17:30668339-30668361 CCTCCCCCGTGCCACCTCCTTGG - Intergenic
1146349810 17:32084453-32084475 CCTCCCCCGTGCCACCTCCTTGG - Intergenic
1146530933 17:33607250-33607272 CTGCCCAAACGCAACCTCCTGGG + Intronic
1148860718 17:50603010-50603032 CCAGCCCAGTGCCACCACCTGGG - Exonic
1149869539 17:60169449-60169471 CCACCCAGATGGTACCCCCTTGG - Intronic
1150133841 17:62683754-62683776 CCTCCCACTTCCCACCTCCTGGG - Intronic
1150726185 17:67653204-67653226 CCATCCAACCTCCACCTCCTGGG - Intronic
1151576618 17:74955697-74955719 CCTCCCAGAGGCCACCTCCTGGG + Intronic
1151807592 17:76415727-76415749 TCACTCAAACTCCACCTCCTGGG - Intronic
1151830665 17:76547428-76547450 CCCCCTGAAAGCCACCTCCTTGG - Intronic
1151951920 17:77359374-77359396 CAGTGCAAATGCCACCTCCTTGG - Intronic
1152503623 17:80730755-80730777 CCACCCAAACCCCACCCCCAGGG - Intronic
1153322771 18:3789741-3789763 CCTCCCAAATGCCACAGCCGAGG - Intronic
1153978248 18:10288036-10288058 CTACAGAAATGCCACCCCCTGGG + Intergenic
1156364156 18:36409814-36409836 CCACCCCAAAGCCACCTTCAGGG - Intronic
1157382152 18:47228236-47228258 GCACACACATGCCACTTCCTTGG + Intronic
1158478714 18:57802827-57802849 CCACCCAAATCCCACCTGTGCGG + Intronic
1159495616 18:69199510-69199532 CCAACCAAATTCCACAACCTGGG + Intergenic
1161296303 19:3522321-3522343 CAACATAAATGCCACCCCCTTGG + Intronic
1162373768 19:10293436-10293458 CCGCCCAAATACCACGCCCTAGG - Intronic
1162452332 19:10762739-10762761 CCACCCTTAAGCCACCTCTTGGG + Intronic
1162982475 19:14248558-14248580 CCTCCCCCGTGCCACCTCCTTGG + Intergenic
1163770815 19:19190069-19190091 CTGCTCAAATGTCACCTCCTGGG + Intronic
1164826899 19:31290547-31290569 CCACTGAATTGTCACCTCCTCGG - Intronic
1164907841 19:31981993-31982015 CCACCCATGTGCCAACCCCTGGG - Intergenic
1165303013 19:34984062-34984084 CCAACCAGATGCCACCCACTCGG + Intergenic
1165709098 19:37997055-37997077 ACTCCCAAATACCACCTTCTTGG - Intronic
1165781665 19:38438190-38438212 CAACTCAAATGTCACCTCCTTGG + Intronic
1166596213 19:44052268-44052290 CCACCCCAATCCCACCCCCCGGG - Intronic
1166847794 19:45740373-45740395 CAACCTTTATGCCACCTCCTGGG + Intronic
1166861339 19:45813304-45813326 CTAATCAAATGTCACCTCCTTGG + Intronic
925328146 2:3038705-3038727 CAACCCCATTGCCACCTCCACGG - Intergenic
925372634 2:3358117-3358139 ACACCCACTTCCCACCTCCTCGG + Intronic
925990557 2:9250999-9251021 CCACCCAAATGCCACCTCCTTGG - Intronic
926208236 2:10849150-10849172 CCACCCACAAGTCACTTCCTGGG - Intronic
927423000 2:22952666-22952688 CCCCTCAAGGGCCACCTCCTTGG + Intergenic
927939621 2:27095384-27095406 ACACCCAAACCCCAGCTCCTTGG - Intronic
928692848 2:33818964-33818986 CCTCCCAAATCCTCCCTCCTGGG + Intergenic
929907813 2:46061650-46061672 CAACCCCCAAGCCACCTCCTTGG + Intronic
931258988 2:60600237-60600259 CATTCCAACTGCCACCTCCTTGG - Intergenic
932626672 2:73302025-73302047 CCATTCAAATGTCACTTCCTTGG - Intergenic
933777451 2:85779588-85779610 CCAGCCAGCTGTCACCTCCTTGG - Intronic
933878553 2:86645133-86645155 CTTCTCAAGTGCCACCTCCTAGG - Intronic
933950285 2:87323202-87323224 CCACCCTCATGGCACCTTCTGGG + Intergenic
933983204 2:87570319-87570341 CCACCCAGATGACAGCTTCTTGG + Intergenic
934969327 2:98750326-98750348 CCACCCAAATGACGCCTTTTTGG + Intergenic
936310641 2:111380475-111380497 CCACCCAGATGACAGCTTCTTGG - Intergenic
936329903 2:111538394-111538416 CCACCCTCATGGCACCTTCTGGG - Intergenic
940385723 2:153069096-153069118 CCACCCAAATGTCTCCTACAGGG - Intergenic
941732577 2:168934564-168934586 CCTCCCAACTGACTCCTCCTAGG - Intronic
946015279 2:216599316-216599338 CTGCTCAAATGTCACCTCCTTGG + Intergenic
946033525 2:216723960-216723982 CTATCCAAATGTCACCTCTTGGG - Intergenic
947386243 2:229593417-229593439 CTACTCAAATGCTACCTTCTAGG + Intronic
948878037 2:240840657-240840679 CCTCCCCAGTGCCACCTGCTGGG + Intergenic
1168774280 20:435074-435096 AAAACCAAATGCCAGCTCCTAGG + Intergenic
1168859533 20:1036214-1036236 CTGCTCAGATGCCACCTCCTTGG + Intergenic
1168946772 20:1767477-1767499 ACACCCCAATGCCACTTTCTGGG + Intergenic
1169192324 20:3666242-3666264 CCACCCAACTACCAGCTACTTGG - Intergenic
1169207566 20:3748872-3748894 CCTCCCAAATGCCATCTCCCAGG + Intronic
1171348384 20:24484015-24484037 ACATCCAACTTCCACCTCCTAGG - Intronic
1171947511 20:31391607-31391629 CATCCCAAATGTCACCTCCTTGG + Intergenic
1171987118 20:31668210-31668232 CCCCTCAAATGTCACCTCCTAGG + Intronic
1172029750 20:31973583-31973605 TTGCCCACATGCCACCTCCTTGG - Intronic
1172128224 20:32638123-32638145 ACCCCCAAATGCCAGGTCCTTGG - Intergenic
1172169552 20:32920767-32920789 GCACCCCAACTCCACCTCCTTGG - Intronic
1173633803 20:44537178-44537200 CACCGCAACTGCCACCTCCTGGG + Intronic
1173822031 20:46025788-46025810 CCACCCGCATGCCCCATCCTCGG - Intronic
1174265602 20:49329456-49329478 TCACCCCACTGCCACCTCCCTGG - Intergenic
1174539118 20:51275423-51275445 CTACCCAAATGTCACCTCCTCGG - Intergenic
1175283979 20:57824947-57824969 CCACCCACATGCCACCAACCAGG - Intergenic
1175639040 20:60611342-60611364 CCATCCAAGAGCTACCTCCTTGG + Intergenic
1175717980 20:61268185-61268207 CCAGCTACATGCCACCCCCTGGG - Intronic
1179645183 21:42771231-42771253 CCACCCACCTGCCAGCTCCCGGG + Intronic
1182696025 22:32199920-32199942 CCAGCCCAAGGCCACCCCCTCGG + Intronic
1182716069 22:32356964-32356986 CCAGCCCAAGGCCACCCCCTTGG - Intronic
1183043850 22:35203862-35203884 CCACTCAAAAGTGACCTCCTTGG + Intergenic
1183074470 22:35418062-35418084 CCATCTAAATCCCACCTCCTTGG - Intronic
1183554730 22:38516348-38516370 CAACCCAAATGCCCACTTCTTGG + Intergenic
1183704620 22:39469127-39469149 CCACCCACCTGCCCCCTTCTGGG - Intronic
1184460670 22:44636092-44636114 CACCACAACTGCCACCTCCTGGG - Intergenic
949099337 3:125407-125429 TCACCTAAATGCCACATTCTCGG - Intergenic
950379073 3:12595702-12595724 CCATGCAAATGCCACTTTCTTGG + Intronic
952432074 3:33233583-33233605 CATCCCAAATCCCACCTGCTGGG - Intergenic
953438663 3:42899471-42899493 CCTCTCTACTGCCACCTCCTGGG - Intronic
953553728 3:43925225-43925247 TCCCCCAACTGCCACCTCCAGGG - Intergenic
953582172 3:44167113-44167135 CCACCTCCATCCCACCTCCTTGG - Intergenic
954330403 3:49886908-49886930 TCAGCAAAATGTCACCTCCTGGG + Intergenic
954427148 3:50449455-50449477 CAACCCTGATGCCACCTCCATGG + Intronic
954903938 3:54043811-54043833 CCATTCAAATGCCCCCTTCTGGG - Intergenic
955065196 3:55527896-55527918 CTACCCTATTGCCTCCTCCTAGG - Intronic
955791317 3:62591387-62591409 CTGCATAAATGCCACCTCCTTGG - Intronic
956530821 3:70216703-70216725 CTGCTCAAATGTCACCTCCTGGG + Intergenic
956956861 3:74351370-74351392 CCACACAAATGCCACCCACGAGG + Intronic
957207664 3:77218447-77218469 TCACGCAAACTCCACCTCCTGGG + Intronic
957813105 3:85254288-85254310 CCACCCTAAAGGCACCTCCATGG + Intronic
958071267 3:88616212-88616234 CCATCGAAAAGCCACCTACTTGG - Intergenic
959364520 3:105440278-105440300 CTTCTCAAGTGCCACCTCCTAGG - Intronic
959813868 3:110652534-110652556 CCACCCAAATGTTGCCTTCTTGG + Intergenic
960970981 3:123140051-123140073 CCACTCAAATTTCACCTTCTAGG - Intronic
961582798 3:127896619-127896641 CCACCCAAACACCTCCTACTAGG + Intergenic
961756992 3:129134062-129134084 CAACCCCAATACCTCCTCCTCGG + Exonic
962633210 3:137300876-137300898 TCCTCCAAATGCCACCTGCTTGG + Intergenic
963250609 3:143099690-143099712 CCACAGAAATGCCACCTGATTGG - Intergenic
964846877 3:161054050-161054072 CCCCTAAAATGGCACCTCCTTGG - Intronic
966439154 3:179924314-179924336 CCAGCTAGATGCCACCTTCTTGG + Intronic
967488978 3:190066904-190066926 CAGCTCAAATGCCACTTCCTGGG + Intronic
967977400 3:195043202-195043224 TCCCTCAAATGCCACCTCCTGGG - Intergenic
968207939 3:196821249-196821271 CACCGCAACTGCCACCTCCTGGG - Intronic
972214419 4:36879282-36879304 CCACTCAAATGTCATCTCCTCGG - Intergenic
972710593 4:41590683-41590705 CCACCCAGCTGCCACCTTCTGGG + Intronic
974160469 4:58131921-58131943 GCTCCCAAATGCCCCTTCCTCGG - Intergenic
974752277 4:66156358-66156380 CCACCCAAATGTTACCTTTTTGG + Intergenic
978824562 4:113005753-113005775 CGACCCAAATGCCTCCCACTAGG - Intronic
979663711 4:123287851-123287873 TTACACAAATGCCACCTTCTCGG - Intronic
982884622 4:160763053-160763075 CCAGCCAAATGACCTCTCCTCGG + Intergenic
982887937 4:160806985-160807007 AGACCAAAATGCCACCTCCTGGG + Intergenic
984840992 4:184067291-184067313 TTGCCCAAATGCCACCTCATGGG - Intergenic
985546719 5:513645-513667 GCACACACATGCCACCTCCATGG + Intronic
985818127 5:2141790-2141812 CCACCCAGGTGCCCCCTCCTGGG - Intergenic
986875297 5:12100165-12100187 CCACCCAAACCCCACCTCCATGG - Intergenic
990972954 5:61529649-61529671 CCTCTCTAATGCCCCCTCCTAGG + Intronic
992556223 5:77906200-77906222 CTCCCCAAATGCCACCTTTTAGG - Intergenic
993211516 5:84958425-84958447 GCATCAAAATGCCACCTCTTAGG + Intergenic
993978337 5:94510986-94511008 ACCTCCAAATGCCACCACCTTGG - Intronic
994372203 5:98979758-98979780 CACTGCAAATGCCACCTCCTGGG - Intergenic
995601825 5:113805726-113805748 CCACCCAAGTGGCAGATCCTTGG - Intergenic
996379608 5:122849669-122849691 GCACCCAAATGTTACTTCCTGGG + Intronic
997612260 5:135223435-135223457 CCACTGAGATGTCACCTCCTTGG - Intronic
997704776 5:135938428-135938450 CAACCTGAATGCCATCTCCTTGG + Intronic
998339289 5:141402962-141402984 CCAACCAAATGCCAGCTCCGCGG + Exonic
998434486 5:142095950-142095972 CCACCCTAAAACCACTTCCTGGG + Intergenic
999154621 5:149449714-149449736 CAACCCAGATGTCACCTCCCCGG + Intergenic
999564517 5:152842628-152842650 CCTCCCAAATTCCTCCTCCATGG - Intergenic
1000064462 5:157683079-157683101 CAACCCAATTTCCTCCTCCTAGG - Intergenic
1001484854 5:172112369-172112391 CCACCAAAATCCCACTTCCAGGG - Intronic
1001729434 5:173939367-173939389 ACATACAAATGCCACCTACTAGG + Intronic
1001889958 5:175330533-175330555 ACTCCCAAAGGCCACCTTCTGGG + Intergenic
1002053931 5:176587677-176587699 GCACCCACATGCCACCTTCTGGG - Intronic
1002461528 5:179376106-179376128 TCAGCCCAATGCCCCCTCCTGGG + Intergenic
1002872211 6:1177230-1177252 CCACCCAAATTCCACATCCGAGG + Intergenic
1003423986 6:5984301-5984323 CAACCTCAATGCCACCTCTTCGG - Intergenic
1004426544 6:15510739-15510761 CCACCTCAAGGCCAACTCCTTGG - Intronic
1004476989 6:15982356-15982378 TCACCCAAATGCCTCCCACTGGG - Intergenic
1004932381 6:20475014-20475036 CACCCCAAGTTCCACCTCCTGGG + Intronic
1005434455 6:25793378-25793400 CAACACAAATGTCACCTACTGGG - Intronic
1005805291 6:29468569-29468591 CCCTACAAATGCCCCCTCCTGGG - Intergenic
1006858605 6:37154028-37154050 CCCTGCAAATTCCACCTCCTGGG + Intergenic
1007317504 6:41001002-41001024 CCAGCCAATTTCCACCCCCTTGG - Intergenic
1007714955 6:43850544-43850566 CCTCCCCACTGCCACCTCCCTGG - Intergenic
1011744057 6:90392075-90392097 CCACCCAAGTTCCCCCTCCCTGG + Intergenic
1012770319 6:103425025-103425047 CCACCCCACTGCCAGCTCCAAGG + Intergenic
1012963098 6:105643737-105643759 CCAGCCAGCTGCCACCTCCCTGG - Intergenic
1013224949 6:108114073-108114095 CCACCACCACGCCACCTCCTGGG - Intronic
1014254163 6:119144804-119144826 CCACCCATCTACCACCCCCTAGG - Intronic
1014627900 6:123752003-123752025 CCTCCCAAATGCCATTACCTTGG - Intergenic
1015635200 6:135267997-135268019 CCACACAAATGCAACCACTTGGG - Intergenic
1016070568 6:139733472-139733494 CCACTCAAATGTCACCTCCTTGG - Intergenic
1017092159 6:150769504-150769526 TCACTCAACTTCCACCTCCTGGG - Intronic
1017854201 6:158334883-158334905 CCTCATAAATGCCACCTTCTAGG - Intronic
1017967766 6:159281281-159281303 CCACCCCACTGTCACCTCCTTGG + Intergenic
1018472867 6:164112082-164112104 TAATCCAAATGTCACCTCCTTGG - Intergenic
1018731048 6:166650675-166650697 CCAGCAGAATGCCACCTACTTGG - Intronic
1019005833 6:168795606-168795628 TCATTCAAATGCCACCTTCTGGG + Intergenic
1019541818 7:1555098-1555120 GCTCCCACATGCCACATCCTGGG + Intronic
1019707151 7:2502238-2502260 CCCCCCACATCCCACCTCCAGGG - Intergenic
1019741420 7:2676630-2676652 CCAACAAAAGGGCACCTCCTGGG + Intergenic
1022129186 7:27388370-27388392 CAACCCCAAAGCCACCTGCTTGG + Intergenic
1023246376 7:38209356-38209378 TCACGCAACTGCCACCTCCTGGG + Intronic
1023650020 7:42359728-42359750 GCACCCACATGTCACCTCTTAGG - Intergenic
1023834591 7:44060716-44060738 CCTCCCACATCCCACCTGCTCGG - Intronic
1024429872 7:49275188-49275210 CCAACCAATTGCCTCTTCCTGGG - Intergenic
1024551515 7:50566341-50566363 ACACCCAAATGCTCCCGCCTGGG + Intergenic
1028132736 7:87195637-87195659 CCACCACAAGACCACCTCCTAGG - Exonic
1028614948 7:92755603-92755625 CCCAGCAAATGCCACCTCCTTGG - Intronic
1029143065 7:98425277-98425299 CCACCCACATGCCTCCACTTGGG - Intergenic
1030089875 7:105849223-105849245 CCAGCCTTCTGCCACCTCCTTGG - Intronic
1031067474 7:117120639-117120661 CAAATCAAATGTCACCTCCTGGG + Intronic
1031067572 7:117122084-117122106 CAAATCAAATGTCACCTCCTGGG - Intronic
1032384759 7:131514050-131514072 CCACACCAAAGCCACTTCCTGGG - Intronic
1033258331 7:139820891-139820913 CCACCCAAATATCAGCTCCATGG - Intronic
1035605595 8:928113-928135 CCAGCCTGAAGCCACCTCCTAGG + Intergenic
1035689733 8:1552159-1552181 CCACTCAGATGACACATCCTCGG + Intronic
1035731261 8:1854972-1854994 CTCCCCATACGCCACCTCCTGGG - Intronic
1037473243 8:19231588-19231610 CCACCCAAAAGCCACCTGCCTGG + Intergenic
1038401519 8:27287940-27287962 CCCCCCAAGGGCCACCTCCCAGG + Exonic
1038647011 8:29370397-29370419 CAACTCAAATGCCACTTCCCTGG - Intergenic
1039078235 8:33711518-33711540 CCACTCACATGCCATCTTCTTGG + Intergenic
1039473461 8:37827394-37827416 CCACCCACAGGCGACCTGCTGGG - Intronic
1040605085 8:48923686-48923708 ACACCCAAAGGCCAGCTGCTGGG + Intergenic
1041388758 8:57330653-57330675 CCATCCAAATGCCACCTCCTTGG + Intergenic
1041543344 8:59011880-59011902 CAACCCCAATGCCACATCATGGG + Intronic
1042914754 8:73864650-73864672 CAACCCAACCTCCACCTCCTGGG + Intronic
1044066211 8:87703364-87703386 GCTCCCAAATGGCACGTCCTGGG + Intergenic
1045234913 8:100343008-100343030 CCACCTACATCCCTCCTCCTGGG - Intronic
1046104490 8:109649399-109649421 GCACCTCTATGCCACCTCCTGGG - Intronic
1047719620 8:127627473-127627495 CACCCAAAAAGCCACCTCCTCGG + Intergenic
1048219906 8:132531638-132531660 ACCAGCAAATGCCACCTCCTGGG + Intergenic
1048911564 8:139140352-139140374 CCACCAGAATGCCACTACCTAGG + Intergenic
1049113418 8:140664687-140664709 CCACTCAAATTCCAGATCCTGGG - Intronic
1049215197 8:141404608-141404630 CCATCCAAATCCCACCTCCCTGG - Intronic
1049972375 9:832520-832542 TCACCCAATCTCCACCTCCTGGG - Intergenic
1055129830 9:72762330-72762352 GCCTCCAGATGCCACCTCCTTGG - Intronic
1056418730 9:86402955-86402977 CCACCCATATTCCTCTTCCTGGG + Intergenic
1057274584 9:93669592-93669614 CCTCACCAATGCCACCTCCCAGG - Intronic
1057802032 9:98196629-98196651 CCACGCAACCGCCACCTCCCAGG + Intergenic
1058935653 9:109767326-109767348 CCACCCTAATACCACTTCCTTGG + Intronic
1058957858 9:109965899-109965921 CATCTCAAATCCCACCTCCTTGG - Intronic
1060092167 9:120752956-120752978 CCTCCCAAACTCCGCCTCCTGGG + Intronic
1060149535 9:121279456-121279478 CCACCCCAATGCCAACATCTGGG - Intronic
1060476043 9:123987477-123987499 CAGCTCAAATGCTACCTCCTTGG + Intergenic
1062163407 9:135092635-135092657 CCCCGCAAATGCCTCCTCCCTGG - Intronic
1062406903 9:136400930-136400952 CCACCAAAAGCCCACCTCCTAGG - Intergenic
1186498618 X:10032500-10032522 CCACCCCACTGCCTCCTCCTTGG - Intronic
1187461540 X:19491580-19491602 CCACCCACATATCACTTCCTGGG + Intronic
1187562905 X:20419096-20419118 CCAGCCAGATACCACCTCCCAGG - Intergenic
1190165200 X:48067984-48068006 CACTGCAAATGCCACCTCCTTGG - Intronic
1192220382 X:69193827-69193849 CATCCCAAATGTCACCTTCTCGG + Intergenic
1194720672 X:97336613-97336635 CCACTCAACTGACATCTCCTTGG + Intronic
1195394187 X:104393477-104393499 CTACTCAAATGTCACCTCCTTGG - Intergenic
1195569362 X:106381595-106381617 CCTCCCAAACTTCACCTCCTGGG + Intergenic
1197003534 X:121469070-121469092 TAACCCAAATGCCCCCTACTAGG + Intergenic
1197711957 X:129678084-129678106 CCACCCTCATGCCTCCTCCCGGG + Intergenic
1198272176 X:135065325-135065347 TCACCCAGATGCCACCTTATAGG + Intergenic
1198684837 X:139216938-139216960 TCAGCCAAATGCCACTTCCCAGG + Intronic
1199074135 X:143510713-143510735 CCCCCAAAATGCCTCCTCCTCGG + Intronic
1199690162 X:150303635-150303657 CCACCCAATTGCCTCCACCACGG + Intergenic
1200138756 X:153886992-153887014 CCTCCCCAGTGCCCCCTCCTAGG + Intronic