ID: 925990742

View in Genome Browser
Species Human (GRCh38)
Location 2:9252169-9252191
Sequence CAGTCCTAGCAGCTGGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925990742_925990745 -10 Left 925990742 2:9252169-9252191 CCTGACACCAGCTGCTAGGACTG 0: 1
1: 0
2: 0
3: 10
4: 141
Right 925990745 2:9252182-9252204 GCTAGGACTGCATTGGAGTGAGG 0: 1
1: 0
2: 3
3: 4
4: 107
925990742_925990746 7 Left 925990742 2:9252169-9252191 CCTGACACCAGCTGCTAGGACTG 0: 1
1: 0
2: 0
3: 10
4: 141
Right 925990746 2:9252199-9252221 GTGAGGCCACTCAGCCTTGAAGG 0: 1
1: 0
2: 1
3: 15
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925990742 Original CRISPR CAGTCCTAGCAGCTGGTGTC AGG (reversed) Intronic
901027677 1:6287317-6287339 CAGGCCCAGCAGCTGGTCTCTGG - Intronic
901290214 1:8118213-8118235 CAGTTCTAGGACCTGGTGTAGGG + Intergenic
901438575 1:9264069-9264091 CAGCCGGAGCAGCTGGTGCCAGG + Exonic
901648173 1:10727764-10727786 CAGCCCTGGCAGCTGCTGCCTGG - Intronic
902611988 1:17602953-17602975 CAGGCCTGGGAGCTGGTGTGGGG + Intronic
903301282 1:22380348-22380370 GAGTCCCAGCTGCTGATGTCAGG - Intergenic
904868642 1:33602462-33602484 CAGTCCTGGGAGCTGGAGTACGG + Exonic
907332930 1:53683134-53683156 CAGTCCTGGCATATGGAGTCTGG + Intronic
907627351 1:56043272-56043294 CAGCCCTAGCAGCAGGGGACAGG - Intergenic
918578342 1:186093320-186093342 AAGGCCCAGCAGCAGGTGTCTGG + Intronic
918812742 1:189141301-189141323 CAGTCATAGGACCTGGTGTTGGG - Intergenic
1063344390 10:5297762-5297784 CAGTGAAAGCAGCTGGGGTCAGG - Intergenic
1065638673 10:27757482-27757504 GGGTGCTAGCATCTGGTGTCTGG + Intergenic
1066391651 10:34981541-34981563 CAGTCCTACCAGCTTCTGCCTGG - Intergenic
1070911123 10:80119289-80119311 CAGTCCCACCTGCTGGTGTAGGG - Intergenic
1075424215 10:122328904-122328926 TAGTTTTAGCAGCTGGTTTCAGG - Intronic
1078462224 11:11522640-11522662 CAGTCACAGTAGCTTGTGTCAGG - Intronic
1079719043 11:23787427-23787449 CAGTCATAGCAGCTGGGATGGGG - Intergenic
1080596760 11:33780026-33780048 CAGTTCTAGCAGCTGGAGGGAGG - Intergenic
1085202147 11:74708307-74708329 CAGGCCTGGCAGCAGGAGTCTGG + Exonic
1090402885 11:126460287-126460309 CACACCTACCAGCTGCTGTCAGG - Intronic
1091580702 12:1786941-1786963 CACTCCTAGCAGCTGGTAAAGGG + Exonic
1092241422 12:6838560-6838582 CAATCCTAGCCCCTGGTGTCCGG - Intronic
1092284119 12:7119100-7119122 CAGTACCTGCAGCTGGTGGCTGG + Intergenic
1099343553 12:81469718-81469740 CAGTCATAGCATATGGAGTCTGG - Intronic
1102440959 12:112963534-112963556 CACTCCTAGCAGCTGGGGATGGG - Intronic
1102463574 12:113115063-113115085 CAGTGCTGGCGGCTGGTGCCCGG - Intronic
1103437364 12:120937244-120937266 CACTCCTAGCAGCTGGGGAATGG - Intergenic
1103918063 12:124386081-124386103 CAGTCCTGGCCTCTGGGGTCTGG + Intronic
1104559964 12:129834545-129834567 CAGTGCTAGCAGCTGGTGCATGG - Intronic
1110390953 13:74973352-74973374 CAGTACTAAAAGGTGGTGTCAGG - Intergenic
1112783315 13:102925816-102925838 CAGCCCCAGCAGCTGCTGTAGGG - Intergenic
1120528152 14:85601476-85601498 CTGTCCTAGCAGCTGGTGAATGG + Intronic
1121511278 14:94515022-94515044 CAGGCCCAGCAGCAGGTGTGTGG - Intronic
1121775468 14:96587731-96587753 CAGCCCTATCAGCTGGTGGGGGG + Intergenic
1122371720 14:101232846-101232868 CAGGCCCAGGAGCTGGGGTCTGG + Intergenic
1122779101 14:104136205-104136227 CAGTCCGCGTGGCTGGTGTCTGG + Intergenic
1123651432 15:22479090-22479112 GAGCCCTGGCAGCTGGGGTCAGG - Intergenic
1128942541 15:71800398-71800420 CAGTCCTGGGAGCAAGTGTCAGG - Intronic
1130146114 15:81274962-81274984 CAGTCCTTGGAGCTGGAGCCTGG - Intronic
1130850848 15:87792255-87792277 CAGTCCTTGCATATGGTGTCTGG + Intergenic
1130856888 15:87847560-87847582 CCGCCCCAGCAGCTGGTGTGAGG - Intergenic
1133044365 16:3078624-3078646 CTGTCTTTGCAGCTGGTTTCTGG + Intronic
1134447895 16:14344514-14344536 CAAGCATCGCAGCTGGTGTCTGG - Intergenic
1138194888 16:55044717-55044739 CAGTCCCTGCAGCTGGAATCTGG - Intergenic
1138589560 16:57992360-57992382 GGGTCCTAGAAGCTGGTGCCAGG - Intergenic
1139775807 16:69316491-69316513 CAGTGCCAGCAGCTGCTTTCAGG + Intronic
1142495520 17:304578-304600 CACTCTGAGCAGCTGGTGCCTGG + Intronic
1143660121 17:8319370-8319392 CAGTCCTCATAGATGGTGTCTGG - Exonic
1144284474 17:13759952-13759974 CAGTCCTGGTATCTGGTATCTGG - Intergenic
1144858064 17:18281654-18281676 CAGACCTGGAAGCAGGTGTCAGG - Intronic
1145304511 17:21666027-21666049 CAGGCCTTGCAGCTAGTCTCTGG + Intergenic
1146641669 17:34546654-34546676 GAGTCCTCTCAGCTGGTGGCTGG - Intergenic
1149222727 17:54434328-54434350 CAGTCCAAGTAGCTGGTTGCAGG + Intergenic
1149894968 17:60422237-60422259 CAGCCTTACCAGGTGGTGTCAGG + Intronic
1151246090 17:72796083-72796105 CAGTCCTAGCAAATGGAGGCTGG - Intronic
1154179930 18:12127242-12127264 GAGACATAGCAGCTGGGGTCAGG + Intronic
1154381054 18:13850196-13850218 TGGTCCTGGCAGCTGTTGTCAGG - Intergenic
1160426929 18:78784087-78784109 CAGTCTCAGCAGCTGCTGCCTGG + Intergenic
1163662944 19:18589366-18589388 CAGTCCTCCCCTCTGGTGTCTGG + Intronic
1165851046 19:38850492-38850514 CAGTCCTACCATCTGGTGAGAGG - Intronic
1166060093 19:40320680-40320702 CTGTCCTAGGAGCTGGTAGCAGG - Exonic
1166112402 19:40630670-40630692 CAGTCCTGACAGCTGGAGGCGGG + Intergenic
1166566302 19:43767532-43767554 CAGTCCAAGTAGCTGGTGAGGGG - Exonic
1166772223 19:45290783-45290805 CAGTCCTCACAGGTGGTGGCAGG - Intronic
1167516268 19:49924791-49924813 CAGACTTAGCAGCTGGACTCAGG - Intronic
925990742 2:9252169-9252191 CAGTCCTAGCAGCTGGTGTCAGG - Intronic
926919810 2:17929336-17929358 CAGTCCTGGCAGCAGGTGAAAGG + Intronic
931088866 2:58864480-58864502 GTGTCAAAGCAGCTGGTGTCTGG + Intergenic
933691077 2:85180062-85180084 CAGTCCTTGCAGCTGTTCCCAGG - Intronic
933829408 2:86195032-86195054 CAATCCTGGCTGCTGGCGTCTGG - Intronic
937118936 2:119428848-119428870 CAGGCCTAGAAGCAGGGGTCAGG + Intergenic
937426707 2:121806026-121806048 CAGACCTAGCAGCGTCTGTCTGG - Intergenic
943022529 2:182592487-182592509 CAGTCATGGAAGCTGGTGTTGGG - Intergenic
943585183 2:189730935-189730957 CAGTTTTAGCAACTGATGTCTGG - Intronic
943702656 2:191003616-191003638 CAGTCATAGCAGCAGGTGAAGGG - Intronic
944836508 2:203585503-203585525 CAGGCCTGGCAGCTGGTAGCTGG - Intergenic
944908486 2:204286240-204286262 CAGTCCTGGCAGGTGGTCTGAGG - Intergenic
946411405 2:219517035-219517057 CAGTCTTAGCAGGTGCTGTTGGG + Intronic
948325912 2:237120675-237120697 GACTCCCAGCAGCTGCTGTCAGG - Intergenic
948741495 2:240049619-240049641 CAGTTCTAGCAAATGTTGTCCGG + Intergenic
1171078129 20:22149731-22149753 CTGTCATAGCATCTGGTGTCTGG - Intergenic
1171522027 20:25783466-25783488 CAGGCCTTGCAGCTAGTCTCTGG + Intronic
1171554798 20:26072417-26072439 CAGGCCTTGCAGCTAGTCTCTGG - Intergenic
1172643486 20:36455691-36455713 CAGGCATAGCAGCTGATGACTGG - Intronic
1175207758 20:57324799-57324821 CAGTCATGGAAGCTGGTGTTGGG + Intergenic
1176655831 21:9588454-9588476 CAGGCCTTGCAGCTAGTCTCTGG + Intergenic
1177742721 21:25173175-25173197 CAGACCTCTCTGCTGGTGTCTGG - Intergenic
1179551376 21:42146083-42146105 CAGCCCTAGGAGCTGGTGCTGGG + Intergenic
1180566709 22:16674237-16674259 GAGACATAGCAGCTGGGGTCAGG - Intergenic
1181113412 22:20615728-20615750 CAGTCCTAGGATCCAGTGTCAGG + Intergenic
1181805532 22:25372469-25372491 AAGTTCTAGCAGGTGGGGTCTGG - Intronic
1181859858 22:25809747-25809769 CCGTCCTTGCTACTGGTGTCGGG - Intronic
1183095811 22:35551694-35551716 GAGGCCGAGCTGCTGGTGTCGGG + Exonic
1184293897 22:43512018-43512040 GCCTCCTAGCAGCTGGGGTCTGG + Intergenic
1184391939 22:44207726-44207748 CAGCCCTGGGAGCTGGTGTCTGG + Exonic
950236087 3:11321380-11321402 CAGTCCCAGCTGTTGGTGGCTGG - Intronic
953456720 3:43048236-43048258 CAGTCTTAGCATCTGGAATCAGG + Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
957212714 3:77280923-77280945 TAGTCCTTGGAGCTAGTGTCAGG - Intronic
958177995 3:90021606-90021628 CAATCCTAGCAGCTGGGGGATGG + Intergenic
961500103 3:127326380-127326402 CATTCCTTGCAGCAGATGTCAGG + Intergenic
961594263 3:128004811-128004833 CAGTCCTGGCAGTTGGGCTCTGG - Intergenic
964046837 3:152338547-152338569 CAGTGGTAGCAGCAGGTGTTGGG + Intronic
964109302 3:153072678-153072700 CTGGACTTGCAGCTGGTGTCTGG - Intergenic
967762202 3:193238974-193238996 CAGTCCTGGCAGTTGGTGTGAGG - Intergenic
968195089 3:196699887-196699909 CAGTTCTAGCAACTTGTGGCAGG - Intronic
968285913 3:197508660-197508682 CAGACCTAGCAGCTTGTGACAGG + Intergenic
970653180 4:18200307-18200329 CAGTCATTGCAGTTGGTGACAGG + Intergenic
972697488 4:41462152-41462174 CAGCCCCAGCATCTGGTGTGGGG + Intronic
977998466 4:103526099-103526121 CAGTCATGGCAGCTGGTATGGGG + Intergenic
978429691 4:108620690-108620712 CAGTCCTTTGAGCTGGTGTAGGG + Exonic
983204749 4:164901038-164901060 GAGTCCTAGAAGCTGCTGTTGGG + Intergenic
986261141 5:6147536-6147558 AGGTACTGGCAGCTGGTGTCTGG + Intergenic
987112715 5:14702076-14702098 CAGTCCCAGCAGCTCGGCTCAGG - Intergenic
991976304 5:72186639-72186661 CAGCACGAGCAGCTTGTGTCGGG - Exonic
1002958569 6:1892911-1892933 CAGTCCTGGCAACTGCTGCCTGG + Intronic
1005984404 6:30861990-30862012 AGGTCCTAGCAGCTGGTAGCAGG + Intergenic
1007593592 6:43038082-43038104 CTGTCCTAGCAGCTGGTGGTTGG - Intronic
1007936460 6:45736975-45736997 CAGTCCTTGCGGCTGGTGAGGGG + Intergenic
1011023571 6:82841398-82841420 CAGTCCCAGCATTTGGTCTCTGG + Intergenic
1014570659 6:123003755-123003777 CAGTGCTAGAAGCTGGGGACAGG + Intronic
1018904103 6:168065134-168065156 CAGCCCTGGGAGCTGGTGTGGGG - Intronic
1019596902 7:1862266-1862288 CAGTCCTCACAGCTGGGGCCAGG - Intronic
1020029253 7:4921234-4921256 CAGTCCAAGCAGATGAGGTCAGG - Intronic
1020332679 7:7036020-7036042 CAGTCCTAGTGTCTGGAGTCTGG + Intergenic
1022976952 7:35567516-35567538 CAGTCCTACCTGCGGGTTTCCGG + Intergenic
1024916592 7:54507270-54507292 CAGGCCTAGCAGGAGGTGTTTGG + Intergenic
1025282523 7:57638641-57638663 CAGGCCTTGCAGCTAGTCTCTGG + Intergenic
1025302199 7:57826769-57826791 CAGGCCTTGCAGCTAGTCTCTGG - Intergenic
1026849566 7:73716487-73716509 TGGTCCTGACAGCTGGTGTCTGG - Intronic
1030615627 7:111735135-111735157 CACCCCTAGCAGCTGGAGCCTGG - Exonic
1031462370 7:122067412-122067434 CAGTGCAAACAGCTGGTCTCTGG - Intergenic
1032456554 7:132077400-132077422 CATTCCTGACAGCTGGTCTCAGG - Intergenic
1038321080 8:26528140-26528162 CTGTTCTAGCAGCTGATGCCAGG - Intronic
1043204556 8:77420626-77420648 CATTCCTAGCAGCTGGAGGATGG + Intergenic
1043374388 8:79632092-79632114 CAGTCCTCAGAGCTGGTGCCAGG - Intronic
1043780273 8:84325351-84325373 CAGTCATAGCAGAGGGTGTTAGG - Intronic
1046817145 8:118597232-118597254 CTGTCCTATCAGCTGCTGTTTGG + Intronic
1050467817 9:5949553-5949575 AAGTCTTAGCAGCTGGATTCTGG + Intronic
1051675489 9:19554238-19554260 AAGTCCAAGCAGCAGGTGTTTGG - Intronic
1056483003 9:87024931-87024953 CTGAACTTGCAGCTGGTGTCTGG - Intergenic
1058565398 9:106279042-106279064 CTTTCCTAACAGTTGGTGTCAGG + Intergenic
1060732814 9:126048942-126048964 CTGCCCTAGAGGCTGGTGTCGGG - Intergenic
1203633548 Un_KI270750v1:91915-91937 CAGGCCTTGCAGCTAGTATCTGG + Intergenic
1186482323 X:9905415-9905437 CAGAGCTAGCAGCACGTGTCAGG + Intronic
1188817123 X:34729257-34729279 GAGTCCTAGAAGATTGTGTCCGG - Intergenic
1195917721 X:109952270-109952292 GAGTCCTAGCTGCTAGTGCCTGG - Intergenic
1198491892 X:137149597-137149619 CAGTTCTATCAATTGGTGTCAGG + Intergenic
1199078429 X:143550005-143550027 TAGTAATAGCAGCTGGTGTTGGG - Intergenic
1199893973 X:152115053-152115075 GAGTCCTTGCAGCTGGTCTTTGG - Intergenic
1200018534 X:153182834-153182856 GAGTCCTTGCAGCTGGTCTTTGG + Exonic