ID: 925993905

View in Genome Browser
Species Human (GRCh38)
Location 2:9276277-9276299
Sequence CACACTCCTCTCTCCTGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 237}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925993905_925993916 9 Left 925993905 2:9276277-9276299 CCTTCTCAGGAGAGAGGAGTGTG 0: 1
1: 0
2: 2
3: 30
4: 237
Right 925993916 2:9276309-9276331 TGGGAAGACAGCAGGGGGAGGGG 0: 1
1: 1
2: 11
3: 88
4: 892
925993905_925993918 19 Left 925993905 2:9276277-9276299 CCTTCTCAGGAGAGAGGAGTGTG 0: 1
1: 0
2: 2
3: 30
4: 237
Right 925993918 2:9276319-9276341 GCAGGGGGAGGGGGAGCCACAGG 0: 1
1: 0
2: 20
3: 167
4: 1460
925993905_925993914 7 Left 925993905 2:9276277-9276299 CCTTCTCAGGAGAGAGGAGTGTG 0: 1
1: 0
2: 2
3: 30
4: 237
Right 925993914 2:9276307-9276329 GCTGGGAAGACAGCAGGGGGAGG 0: 1
1: 0
2: 5
3: 74
4: 739
925993905_925993915 8 Left 925993905 2:9276277-9276299 CCTTCTCAGGAGAGAGGAGTGTG 0: 1
1: 0
2: 2
3: 30
4: 237
Right 925993915 2:9276308-9276330 CTGGGAAGACAGCAGGGGGAGGG 0: 1
1: 0
2: 6
3: 75
4: 817
925993905_925993912 3 Left 925993905 2:9276277-9276299 CCTTCTCAGGAGAGAGGAGTGTG 0: 1
1: 0
2: 2
3: 30
4: 237
Right 925993912 2:9276303-9276325 ACGGGCTGGGAAGACAGCAGGGG 0: 1
1: 0
2: 5
3: 23
4: 382
925993905_925993909 -10 Left 925993905 2:9276277-9276299 CCTTCTCAGGAGAGAGGAGTGTG 0: 1
1: 0
2: 2
3: 30
4: 237
Right 925993909 2:9276290-9276312 GAGGAGTGTGTGCACGGGCTGGG 0: 1
1: 0
2: 2
3: 20
4: 232
925993905_925993910 1 Left 925993905 2:9276277-9276299 CCTTCTCAGGAGAGAGGAGTGTG 0: 1
1: 0
2: 2
3: 30
4: 237
Right 925993910 2:9276301-9276323 GCACGGGCTGGGAAGACAGCAGG 0: 1
1: 0
2: 3
3: 24
4: 262
925993905_925993917 10 Left 925993905 2:9276277-9276299 CCTTCTCAGGAGAGAGGAGTGTG 0: 1
1: 0
2: 2
3: 30
4: 237
Right 925993917 2:9276310-9276332 GGGAAGACAGCAGGGGGAGGGGG 0: 1
1: 1
2: 13
3: 195
4: 1487
925993905_925993913 4 Left 925993905 2:9276277-9276299 CCTTCTCAGGAGAGAGGAGTGTG 0: 1
1: 0
2: 2
3: 30
4: 237
Right 925993913 2:9276304-9276326 CGGGCTGGGAAGACAGCAGGGGG 0: 1
1: 0
2: 1
3: 41
4: 380
925993905_925993911 2 Left 925993905 2:9276277-9276299 CCTTCTCAGGAGAGAGGAGTGTG 0: 1
1: 0
2: 2
3: 30
4: 237
Right 925993911 2:9276302-9276324 CACGGGCTGGGAAGACAGCAGGG 0: 1
1: 0
2: 6
3: 31
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925993905 Original CRISPR CACACTCCTCTCTCCTGAGA AGG (reversed) Intronic
900388365 1:2420828-2420850 CACACTCAACGCTCCTCAGAAGG - Intergenic
901793454 1:11666771-11666793 CACCCTCCTGTTTTCTGAGATGG + Intronic
902189724 1:14753936-14753958 CTCACTCCTGTCTCAGGAGAAGG - Intronic
903131798 1:21284313-21284335 CACAGTCCCCTCTCCTGAGATGG - Intronic
904409094 1:30314188-30314210 CACATTCCCCTGTCCTCAGAGGG - Intergenic
904902405 1:33867838-33867860 CACACTCCTCTCTGGGAAGAGGG + Intronic
904941202 1:34165832-34165854 CACACGCCCCTCTCCTGGGATGG - Intronic
905627020 1:39495813-39495835 CACCTGCCTCTCTGCTGAGATGG - Intronic
905669916 1:39784958-39784980 CACCTGCCTCTCTGCTGAGATGG + Intronic
905882685 1:41474906-41474928 CACTCTGCTCTCCCCTGAGAGGG + Intergenic
906689766 1:47784876-47784898 CACAGTCCCCTCCCCTGAGGAGG + Intronic
906938031 1:50231485-50231507 TTTATTCCTCTCTCCTGAGAAGG + Intergenic
907716246 1:56928850-56928872 CAGGATCCTCTCTCCTCAGAAGG + Intergenic
910080317 1:83334147-83334169 AAATCTCCTCTCTCCTGATAGGG + Intergenic
910335112 1:86119483-86119505 CAGAATCCTCTCTGGTGAGAGGG + Intronic
912937668 1:114018020-114018042 CACTCTTCTCTCTCCATAGACGG - Intergenic
913130447 1:115834088-115834110 CCCATTCCTCTCTCCTCAGTCGG + Intergenic
919247394 1:195005730-195005752 CAAACTTCTGTCTTCTGAGAGGG + Intergenic
921466148 1:215490645-215490667 CACTCTCCTCCCTCCTTAGATGG + Intergenic
921987092 1:221324019-221324041 CCCAAACCTCTCTCCTGAGTTGG - Intergenic
923024103 1:230190642-230190664 CTCTCTCTTCTCTCCTGAAACGG + Intronic
923261646 1:232273569-232273591 CGAAATCCTCTCTCCTTAGAAGG - Intergenic
923569645 1:235102094-235102116 CACATGCGTCACTCCTGAGATGG - Intergenic
924503260 1:244656383-244656405 CACACTCTTCTTCCATGAGAAGG - Intronic
924795849 1:247291695-247291717 CTCCCTCCTGTCTCCTCAGAGGG - Intergenic
1063324005 10:5079210-5079232 CCCACTCCTGCCTCCTGGGAAGG - Intronic
1065659619 10:27992366-27992388 CACAGTGTTCCCTCCTGAGAAGG - Intronic
1067090880 10:43265413-43265435 CACACTCCCTGCTCCTGAGAAGG - Intronic
1067204696 10:44202730-44202752 CACATCCCTCCCACCTGAGAAGG - Intergenic
1070808467 10:79285079-79285101 AACGCTCCCCTCTCCAGAGATGG - Intronic
1070832803 10:79430631-79430653 CACCATCCTCTCTCCTGACAGGG - Intronic
1071213145 10:83367502-83367524 AACACCCCTCTCTCCTGCCAAGG + Intergenic
1072370426 10:94761073-94761095 CAGCCTCCTCATTCCTGAGATGG + Intronic
1074363389 10:112839784-112839806 GGCGCTCCTCCCTCCTGAGAGGG - Intergenic
1076188019 10:128463946-128463968 CACAAGCCCCTGTCCTGAGAGGG - Intergenic
1076320803 10:129580146-129580168 AATACTCCTCCCTGCTGAGACGG - Intronic
1078132158 11:8621735-8621757 CACAGGCATCTCTCCTGAGGAGG + Exonic
1078246731 11:9580214-9580236 CACACTCTTCTCCACAGAGAAGG - Intronic
1079184790 11:18227211-18227233 CACACTCCCCTCTGCTTTGATGG - Intronic
1081631807 11:44694427-44694449 CACAGTCCTCCAACCTGAGAGGG + Intergenic
1081747688 11:45484469-45484491 CGCCATCCTCTCTCCTGACAAGG - Intergenic
1083281631 11:61630267-61630289 CTGACTCCACTCTGCTGAGAAGG + Intergenic
1083792878 11:64997136-64997158 CACCATCCTCTTTCCAGAGAAGG - Intergenic
1084341402 11:68504822-68504844 CACACTGCTATCTCCAAAGAAGG - Intronic
1085229257 11:74950554-74950576 CACACTCTTCTCTTGTGAGAGGG + Intronic
1085270869 11:75269173-75269195 AAGCCTCCTCTTTCCTGAGAAGG + Intronic
1085556651 11:77428787-77428809 GGCACCCCTCTCTCCTGATACGG - Intronic
1086701075 11:89901002-89901024 CACCCTCCTCTGTCCTGTGCCGG - Intergenic
1086705092 11:89943525-89943547 CACCCTCCTCTGTCCTGTGCCGG + Intergenic
1088908929 11:114175961-114175983 CACACCCCTCTCCCCTGAGTAGG - Intronic
1088909902 11:114183012-114183034 CAAAATCCTCTCTCCTGAGGAGG - Intronic
1089203488 11:116739835-116739857 CACCCACCTCTCCCCTGACAAGG + Intergenic
1089776751 11:120843049-120843071 AACACTTCTCTCTGCTGAGATGG - Intronic
1091095793 11:132821056-132821078 CTCACTCCTCTAACCAGAGAAGG - Intronic
1091822308 12:3484891-3484913 CACACTCCCCACTCCCCAGAAGG - Intronic
1094201204 12:27796279-27796301 TACAGTCCTTTCTTCTGAGAGGG - Intronic
1094692103 12:32779609-32779631 CACACACCCAACTCCTGAGATGG - Intergenic
1096359496 12:50971465-50971487 CACATTTCTTTTTCCTGAGATGG + Intergenic
1096482182 12:51949820-51949842 CACATTCCTCTCTTCTTATAAGG - Intergenic
1098147576 12:67513295-67513317 CACACTGGTCTCTCATGGGAAGG + Intergenic
1101706794 12:107228133-107228155 CCTACACCTCTCTCCTAAGAAGG + Intergenic
1102059757 12:109923587-109923609 CCCAGTCCTCTTTCCTGGGAGGG - Intronic
1102686832 12:114731532-114731554 TACACTTCTCTCTTTTGAGATGG + Intergenic
1102695984 12:114799853-114799875 CACGCTCCCCTCTGCTGAAAGGG + Intergenic
1103126195 12:118424484-118424506 CAAACTCTTCTCTAGTGAGAAGG - Intergenic
1104359202 12:128116203-128116225 CCCACCCCTCCCTCCTGACAAGG + Intergenic
1108625439 13:52224186-52224208 CACCCTCCCCTCTCTTGGGAGGG - Intergenic
1108660621 13:52582224-52582246 CACCCTCCCCTCTCTTGGGAGGG + Intergenic
1109436340 13:62308643-62308665 CACAATCCACTCTCATGAGTTGG + Intergenic
1110142871 13:72152480-72152502 CAGACTTCACTCTCCTGAAATGG + Intergenic
1110317527 13:74128344-74128366 CACACTGCCCTCCCCTGAAAGGG - Intronic
1114061001 14:19015757-19015779 CATACACCTTGCTCCTGAGATGG - Intergenic
1114101256 14:19384222-19384244 CATACACCTTGCTCCTGAGATGG + Intergenic
1114594295 14:23898422-23898444 GACACTCCTCACTTCTCAGACGG + Intergenic
1114621697 14:24099897-24099919 CACCCACCCCTGTCCTGAGATGG - Intronic
1118362004 14:65064687-65064709 CACATGCCTCTCCCTTGAGAGGG + Intronic
1118745554 14:68770529-68770551 CCCTGTCCTCTCTCCTGAAAAGG + Intergenic
1119827764 14:77671730-77671752 CACATTCCTGTCTCCTGGGATGG - Intergenic
1120542948 14:85773478-85773500 AACACTCCTCTCTCAAGAGTTGG - Intergenic
1121465492 14:94112850-94112872 CACACTTCTCTGTACTGAGTTGG - Intronic
1122871225 14:104639981-104640003 CACAATCCTCTCTCCTGACCTGG + Intergenic
1125713810 15:41807577-41807599 CAGACTCCTCTCTCCAGCAAAGG - Intronic
1129923819 15:79344222-79344244 CTCACTCCTCACTCCTGAAAAGG - Intronic
1130883932 15:88077892-88077914 CACACTGCTCTGTCCTCAGTTGG - Intronic
1132925475 16:2427155-2427177 CACTCACCTCTCTTCTGAGACGG + Intergenic
1133141297 16:3746625-3746647 GACACTCCTTTCCCCTGACATGG - Intronic
1133337329 16:5014666-5014688 CACACTCCCATCTCCCCAGATGG - Intronic
1133510113 16:6449945-6449967 CACACAGCTCTCTCCTGACCTGG - Intronic
1134052089 16:11144481-11144503 CACCCTCCCCTCAGCTGAGAGGG + Intronic
1138191343 16:55016558-55016580 CCTGCCCCTCTCTCCTGAGAGGG - Intergenic
1139308990 16:66012465-66012487 CACTCTCCTCACTCCAGAAAGGG - Intergenic
1139374193 16:66486673-66486695 CACATTCATCTCTCCTGGAATGG + Intronic
1140143771 16:72285663-72285685 CATACTCCCCTGCCCTGAGAAGG - Intergenic
1147321662 17:39650225-39650247 CACACTGCCATCTCCTGATACGG - Intronic
1149996824 17:61410074-61410096 CACTCTCCACTCTCCCAAGAGGG - Intergenic
1150632766 17:66891710-66891732 GACACTCCTCACATCTGAGATGG - Intergenic
1151803342 17:76390623-76390645 CACCCGCCTCTGACCTGAGAAGG + Exonic
1151924818 17:77187380-77187402 CACACCCCTTTTTTCTGAGACGG + Intronic
1153305271 18:3625113-3625135 CTCATTCCTCTCTCCCGAGCAGG + Intronic
1154015228 18:10609835-10609857 CACACACCTCTCTCCTCAGGGGG + Intergenic
1154190292 18:12225809-12225831 CACACACCTCTCTCCTCAGGGGG - Intergenic
1154354503 18:13614875-13614897 CACACCCGTCTCTGCTGAGGAGG + Intronic
1155025185 18:21934625-21934647 CAACCACCTCTCTCCAGAGAAGG - Intergenic
1156490102 18:37491114-37491136 CACCCTCTTCTCACCCGAGAGGG + Intronic
1156972336 18:43171204-43171226 CACGCTCTTCTCTTCTGTGATGG - Intergenic
1159449476 18:68582002-68582024 GAAATTCCTCTCTCTTGAGAAGG - Intergenic
1161029306 19:2050589-2050611 CACAGTCCTCTCTCCAGCCATGG - Intronic
1161725704 19:5927333-5927355 CACTGTCTTCTCTCCTGAAAGGG - Intronic
1163629934 19:18413108-18413130 CACGCTCCTCGCCCCTGAGTGGG - Intergenic
1164083302 19:21879237-21879259 CACAATCCTGTCTACTGACAGGG - Intergenic
1165351829 19:35279837-35279859 CCCCCTCCCCACTCCTGAGATGG - Intergenic
1166448837 19:42880755-42880777 GACATTGCTCTCACCTGAGAGGG + Intronic
1167211330 19:48135902-48135924 CAGGCTCCTCTCTCCTGGGTGGG - Intronic
925312871 2:2899462-2899484 CACACTCCTATCTGCTGACAAGG - Intergenic
925993905 2:9276277-9276299 CACACTCCTCTCTCCTGAGAAGG - Intronic
927860468 2:26557326-26557348 CAGACCCCTCTCTCGGGAGAAGG + Intronic
928167255 2:28980292-28980314 CTCTCTCCTCTTCCCTGAGATGG - Intronic
929875685 2:45794623-45794645 CACACATCTCCCTCCAGAGACGG - Intronic
930332375 2:50001897-50001919 GGCACTCCTTTCTCCTAAGATGG - Intronic
933849245 2:86352453-86352475 GACACTCTTCTCTCCTGACCTGG + Intergenic
935973475 2:108554660-108554682 CACACTCCTCTCAGCTGTAATGG - Intronic
936921888 2:117697269-117697291 CACAGTCCTCTCTCCAGAGGTGG + Intergenic
937691434 2:124760140-124760162 CACACCCCCTTCTCCTGAGTGGG - Intronic
938549747 2:132369094-132369116 CCCACTCCTTTGTCTTGAGATGG - Intergenic
938608644 2:132923129-132923151 CACACTTAATTCTCCTGAGAAGG + Intronic
938661706 2:133493791-133493813 CTCACTCTTCTTTCTTGAGATGG - Intronic
938687663 2:133756282-133756304 CGCACTGCTCTCTACTGTGATGG - Intergenic
939366124 2:141233382-141233404 AACATTTCTCTCTCCTGTGATGG + Intronic
939520268 2:143221751-143221773 CACATTCTTCTCTCCTTAGATGG + Intronic
939873214 2:147548049-147548071 CACTCTCCTCCCTCCTGACAAGG + Intergenic
940234345 2:151493810-151493832 CACACCCTTTACTCCTGAGATGG - Exonic
940245526 2:151611281-151611303 CACATTCCTCATTTCTGAGAGGG + Intronic
942074901 2:172348561-172348583 CATACTCCTCTCGCCTCAGAAGG - Intergenic
942146599 2:173032983-173033005 TTCACTTCTCTCTCCTGACAGGG - Intronic
942655250 2:178208550-178208572 CACACACCTCTCTCCTGTATTGG + Intronic
942655534 2:178210845-178210867 CACACCCCTCTCTGCTGGAATGG + Intronic
943005722 2:182386384-182386406 GACACTCCTCACTTCTTAGATGG - Intronic
943883620 2:193182055-193182077 CACACTGCTCTTTGCTGAGCAGG - Intergenic
946176165 2:217923010-217923032 CACATTCCGGGCTCCTGAGAGGG - Intronic
946551206 2:220803824-220803846 CACACTCACCTATGCTGAGAAGG + Intergenic
946713133 2:222526423-222526445 CACACTGGTGGCTCCTGAGATGG + Intronic
948786490 2:240355497-240355519 CTCACTCTTCTCTCCGGAGAGGG + Intergenic
1171522667 20:25787485-25787507 GACACCCCTCTCCCCTGGGAGGG + Intronic
1171530413 20:25849454-25849476 GACACCCCTCTCCCCTGGGAGGG + Intronic
1171554160 20:26068398-26068420 GACACCCCTCTCCCCTGGGAGGG - Intergenic
1172054262 20:32143174-32143196 CACTCTTCTCCCTCCTGAGCTGG + Intronic
1176522969 21:7838569-7838591 TACTCTGCTCTCTCCTGGGACGG + Intergenic
1178656989 21:34468581-34468603 TACTCTGCTCTCTCCTGGGACGG + Intergenic
1178719046 21:34992134-34992156 CCCGCTTCACTCTCCTGAGAGGG - Intronic
1179058919 21:37961717-37961739 CACACCCCTCTTTCCTCAGGTGG - Intronic
1179567612 21:42258920-42258942 CAAACTCCCCTCACATGAGAAGG - Intronic
1180479482 22:15738369-15738391 CATACACCTTGCTCCTGAGATGG - Intergenic
1180610717 22:17095977-17095999 CACCCTCCTCTCTCTTGAGAGGG - Intronic
1181026128 22:20128779-20128801 CACAGCCTTCTCTCCTGAGCTGG - Intergenic
1181374038 22:22441696-22441718 GACACTCCTCACTTCTTAGATGG - Intergenic
1181897856 22:26126494-26126516 CATCGTCCTCTCTCCTGTGATGG - Intergenic
1182509459 22:30808644-30808666 CACACTTCTCTCTTCTCATAAGG - Intronic
1184386598 22:44180076-44180098 CACTCTCCTCCCTCCTGCCAGGG - Intronic
1185045472 22:48526369-48526391 CCCACTCTGCTCCCCTGAGAAGG - Intronic
949488734 3:4566845-4566867 AACACTCAACTCTCCTGAGGAGG - Intronic
950788906 3:15456719-15456741 GACACTCCTCTCACTTCAGAAGG - Intronic
951301072 3:20997164-20997186 CTCTCACCTCTCTCCTGAGCTGG - Intergenic
953106000 3:39879710-39879732 CACACTCTTCTTTCCTGTGAAGG + Intronic
953905523 3:46866547-46866569 AACATTCCTCCCTCCTGTGATGG - Intronic
953990287 3:47478078-47478100 CAAAGTCTTCTCTCCAGAGAGGG + Intergenic
954805670 3:53218577-53218599 CTCCATCATCTCTCCTGAGAGGG - Intergenic
955037547 3:55283563-55283585 CACCCTTCTACCTCCTGAGAGGG - Intergenic
955086136 3:55704914-55704936 CTGAATCCTCACTCCTGAGATGG + Intronic
955708871 3:61757838-61757860 CACACCCCTCTCCCCAAAGAAGG - Intronic
956427882 3:69155457-69155479 CCCACTCCTGTCTCCACAGAGGG - Intergenic
956561917 3:70587699-70587721 GTCTCTCCTCTCTCCTAAGATGG + Intergenic
956711707 3:72044036-72044058 CCCACTGCTCTCTGCTGATAGGG + Intergenic
956921972 3:73939409-73939431 CACACTCCCTTCTCCAGAGAAGG - Intergenic
957143596 3:76393741-76393763 TACACTCCTCTGTCCAGAGATGG - Intronic
959906157 3:111713024-111713046 CACTCCCCACTCTCCTGGGAAGG + Intronic
960045457 3:113193179-113193201 CTCAGTCTTCTCTCCTAAGATGG + Intergenic
960952582 3:123009201-123009223 CACTCTCCACTCTCTGGAGAGGG + Intronic
961529513 3:127531997-127532019 CAAACTCCTACCCCCTGAGAGGG - Intergenic
963771541 3:149391230-149391252 CTCACTCCTCTCCCCTCATAGGG + Intergenic
966668913 3:182505469-182505491 GACAGTCCTCTCTGCTAAGATGG + Intergenic
967791595 3:193555190-193555212 CCCGCTCCTCACTCCTGAGAAGG - Intronic
968962605 4:3753074-3753096 CAACCTCCTCTCTCCTCAGCCGG - Intergenic
969042217 4:4307986-4308008 TCCACTCCTCTCTCCTGGCACGG + Intronic
972136351 4:35899558-35899580 CACACACCTATCTCCAAAGAAGG + Intergenic
973577468 4:52304941-52304963 CACACTCTTCTCTCCTTATCAGG - Intergenic
980827819 4:138093150-138093172 CACACTTTTCTCTCCTGCTATGG + Intergenic
980852235 4:138396628-138396650 CACACTCTTCACTCCAGAGCAGG - Intergenic
981331259 4:143513349-143513371 CCCACTCTTCTCTCCCGAGCCGG + Intergenic
981890252 4:149727890-149727912 CACAGTCAGCTCTCCTGAGCAGG - Intergenic
983122964 4:163911385-163911407 CACACACCTCTCCTCTGATAGGG - Intronic
984561336 4:181274330-181274352 TTCACTCCTCTCGCCTGAAATGG - Intergenic
985674107 5:1221512-1221534 CACCCACCTCCCTCCTGGGATGG - Intronic
985689755 5:1300627-1300649 CAGACTCCTCTCTCCAGGGCGGG + Intergenic
986089492 5:4489816-4489838 ATCAGTCCTCCCTCCTGAGACGG + Intergenic
987733964 5:21814125-21814147 CACACTCATTTCTCCTGTGGTGG - Intronic
989469639 5:41800409-41800431 CACCCTTCTCTATCCTGAGAAGG + Intronic
992189001 5:74272424-74272446 ACCAATCCTCTCCCCTGAGAGGG + Intergenic
997936790 5:138119325-138119347 CACACTCCTGTCTACTTAGGAGG - Intronic
998639761 5:143996204-143996226 CATTCTCCTTTATCCTGAGAGGG + Intergenic
999234452 5:150082088-150082110 CACTCTCCTCTCTCCAGGCAGGG + Intronic
1002862922 6:1095873-1095895 CACACTCCTCTGTCCCCACACGG + Intergenic
1006390057 6:33753050-33753072 CACAGTCCTGTGTCCTTAGATGG - Intergenic
1006638783 6:35478263-35478285 CACAATACTCACTCCTGAGAGGG + Exonic
1006655210 6:35585931-35585953 GCCACTCCTCCCTCCTGACAAGG + Intronic
1007026879 6:38585124-38585146 CATGCTCTTGTCTCCTGAGATGG - Intronic
1014873656 6:126628482-126628504 CATGCTCCTCTCTACTGGGATGG - Intergenic
1014988652 6:128046317-128046339 CACACTCTTTTCTCCTGCAAGGG - Intronic
1015403440 6:132812383-132812405 CACAAACCTCCCTCCTTAGAGGG - Intergenic
1016489683 6:144583813-144583835 CACAATCTTGTCTTCTGAGATGG + Intronic
1017298030 6:152821902-152821924 CATGCTCCTCTCTCCTCAAAGGG + Intergenic
1022231647 7:28419813-28419835 GACACTCCTTTTTTCTGAGAAGG + Intronic
1022467867 7:30663564-30663586 CACATTCCCCTCTGCTGGGAAGG - Intronic
1022503312 7:30895922-30895944 CACACCCCACTCTCCTGCCAGGG - Intergenic
1024700172 7:51898436-51898458 CCCACTGCACTCTCCTGAGCAGG + Intergenic
1027298090 7:76799413-76799435 AAATCTCCTCTCTCCTGATAGGG + Intergenic
1028761051 7:94497000-94497022 CACACCCATGTCACCTGAGAAGG - Intergenic
1029497180 7:100902289-100902311 CCCACACCTCTCTCCTTGGAAGG - Intergenic
1032094714 7:128932303-128932325 CACCCTCTTCTTCCCTGAGAGGG + Intergenic
1032151175 7:129431397-129431419 CACCCTCCTCTCTCCATAAAGGG - Intergenic
1033603532 7:142908266-142908288 CAACCTCCTTTTTCCTGAGATGG + Exonic
1033651199 7:143345444-143345466 CGCGCTCCGCACTCCTGAGAAGG - Intronic
1034226384 7:149487138-149487160 CACACTCCCTTCTTATGAGATGG + Intronic
1034497835 7:151432820-151432842 CACACTCCTGTTCCCTGATAAGG + Intronic
1035276614 7:157751828-157751850 CTCCCTCCTCTCTCTTTAGAAGG - Intronic
1035454147 7:158997953-158997975 CACGCTCCCCTCTCCTCAGAGGG + Intergenic
1035454165 7:158998005-158998027 CACGCTCCCCTCTCCTCAGTGGG + Intergenic
1035454184 7:158998055-158998077 CACGCTCCCCTCTCCTCAGTGGG + Intergenic
1035454218 7:158998157-158998179 CACGCTCCCCTCTCCTCAGTGGG + Intergenic
1035454235 7:158998207-158998229 CACGCTCCCCTCTCCTCAGTGGG + Intergenic
1035454252 7:158998258-158998280 CACGCTCCCCTCTCCTCAGTGGG + Intergenic
1035454269 7:158998309-158998331 CACGCTCCCCTCTCCTCAGTGGG + Intergenic
1035454288 7:158998359-158998381 CACGCTCCCCTCTCCTCAGTGGG + Intergenic
1035454306 7:158998411-158998433 CACGCTCCCCTCTCCTCAGTGGG + Intergenic
1035454325 7:158998463-158998485 CACGCTCCCCTCTCCTCAGTGGG + Intergenic
1035454343 7:158998515-158998537 CACGCTCCCCTCTCCTCAGTGGG + Intergenic
1035454376 7:158998618-158998640 CACGCTCCCCTCTCCTCAGTGGG + Intergenic
1035454410 7:158998719-158998741 CACGCTCCCCTCTCCTCAGTGGG + Intergenic
1035454428 7:158998771-158998793 CACGCTCCCCTCTCCTCAGTGGG + Intergenic
1035454462 7:158998875-158998897 CACGCTCCCCTCTCCTCAGTGGG + Intergenic
1036699419 8:11002178-11002200 CACCCTCCCCAATCCTGAGAGGG + Intronic
1037069899 8:14631189-14631211 CAGACTCCTCACCCCTGAGGAGG - Intronic
1037564440 8:20105754-20105776 CACCCTCATCTCTGCTGAGTAGG + Intergenic
1037730133 8:21517267-21517289 GGCACTCCACTCTCCTGGGATGG - Intergenic
1038059759 8:23899879-23899901 CTCCCTCCTCTCTCCTGGCATGG - Intergenic
1040511739 8:48102019-48102041 CACACTCCTCTCACCCAAGCTGG - Intergenic
1040997278 8:53414443-53414465 CAAGCTCCTCTCCCCTGCGAAGG + Intergenic
1042227167 8:66522942-66522964 CCCACTCCTTGCTCCTGAGATGG - Intergenic
1042498939 8:69488381-69488403 CACTCTTCTCTTTCCTGAGATGG - Intronic
1043876555 8:85492582-85492604 CACCCTGCTCTGTCCTGAGCAGG + Intergenic
1044256489 8:90069592-90069614 CTCTCTCCTCTCTCCTCACAGGG + Intronic
1046020754 8:108661846-108661868 CAAACTCCTTCCTCCTTAGAAGG - Intronic
1047210739 8:122837988-122838010 CACCCTCCTCTCCCCTAAGCGGG - Intronic
1048813467 8:138309363-138309385 TCCACCCCTCTCTCCTGGGAAGG - Intronic
1048953344 8:139514088-139514110 CAGAGTCCTCCATCCTGAGAGGG - Intergenic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1051672722 9:19528349-19528371 CACAGTGCTGGCTCCTGAGATGG + Intronic
1051813777 9:21080443-21080465 CTGTCTCCTCTTTCCTGAGAGGG - Intergenic
1052024066 9:23555806-23555828 GACACACCTCCCTCCTGGGAAGG + Intergenic
1056714124 9:89014236-89014258 CAACCTCCTCTCCCCTGACATGG - Intronic
1057286410 9:93758340-93758362 CACACTCCAATCTCCAGGGAAGG - Intergenic
1061169163 9:128941964-128941986 CACTCTCCTCTCCTCTCAGATGG + Exonic
1186779726 X:12900486-12900508 CACACTCCCCACTCCTCCGAGGG + Intergenic
1189302010 X:39958804-39958826 AGCACTCCTCACTCCTAAGATGG + Intergenic
1189910247 X:45803954-45803976 CACTTTCTTCTCTCGTGAGAAGG + Intergenic
1190382969 X:49857300-49857322 CACACTGCTCTCTGATGAGTTGG - Intergenic
1191068999 X:56380349-56380371 GACACTCCTCACTTCTCAGATGG + Intergenic
1193864519 X:86714682-86714704 CACAGTCCACTCTCCAGAGCTGG + Exonic
1196031938 X:111101308-111101330 CACACTCCTCTCACCTGCCTGGG - Intronic
1196067085 X:111475761-111475783 CACACTACTCTGTCATCAGACGG - Intergenic
1197610437 X:128632400-128632422 CACACTCCTCTTTCTTAGGAAGG + Intergenic