ID: 925994627

View in Genome Browser
Species Human (GRCh38)
Location 2:9281993-9282015
Sequence GAGCATGAGCAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 860
Summary {0: 1, 1: 0, 2: 6, 3: 95, 4: 758}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925994627_925994631 26 Left 925994627 2:9281993-9282015 CCTTCTTCCCTCTGCTCATGCTC 0: 1
1: 0
2: 6
3: 95
4: 758
Right 925994631 2:9282042-9282064 CACTTTATGAAAGAAAACTGAGG 0: 1
1: 1
2: 2
3: 33
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925994627 Original CRISPR GAGCATGAGCAGAGGGAAGA AGG (reversed) Intronic
900320875 1:2082996-2083018 GGACATGAGGAGAGGGAGGACGG - Intronic
900597589 1:3489576-3489598 GAGCATCAGCAGTGGGGGGAGGG - Intergenic
900908125 1:5575230-5575252 GAGCATGATGAGAAGGCAGATGG - Intergenic
900974438 1:6008300-6008322 GAGGATGAACAGAGGAACGAGGG - Intronic
901094896 1:6670293-6670315 GCCCATGAGAAGAGGGAATATGG - Intronic
901449337 1:9326450-9326472 AGGCATGACCAGAGGGAACAGGG + Intronic
901634181 1:10663084-10663106 GCACATGAGCAGAGAGAACATGG - Intronic
902412479 1:16219509-16219531 GACCAGGAGCAGTGGGGAGAGGG - Intergenic
903538758 1:24084710-24084732 GAGCATGGGGAGAGGCCAGAAGG + Intronic
903581913 1:24377393-24377415 GAGCAAGAGGAGAAGGGAGAAGG - Intronic
904040308 1:27580422-27580444 GAGCAGGAGAAAAGGGAAGAGGG - Intronic
904331069 1:29758102-29758124 GAGCATGTGCAAAAGGGAGAGGG + Intergenic
904480732 1:30791713-30791735 GAGAAGGAAGAGAGGGAAGAAGG + Intergenic
904568428 1:31442592-31442614 GAGGAGGAGCAGTGGGAAGTGGG - Intergenic
904807277 1:33140873-33140895 GAGCCTGAGCAGAAGGAGAAGGG - Intergenic
905235512 1:36543462-36543484 GAGAATGAGAAGAAGGAAGTGGG - Intergenic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905410846 1:37766848-37766870 GAGCGTGAGGAGAATGAAGATGG - Intergenic
906095030 1:43217104-43217126 GAGTGTGTGCAGAGGGATGAGGG + Intronic
906523192 1:46479250-46479272 GGCCATGAGAAGACGGAAGAGGG - Intergenic
907088342 1:51700303-51700325 GAGCCTGAGTAGGGTGAAGAGGG - Intronic
907486879 1:54784177-54784199 AGGCATGAGCAGAGGGAGGTGGG + Intronic
907494637 1:54835786-54835808 CAGCCTGAGAAGAGGGATGAAGG + Intronic
907509639 1:54948631-54948653 GAGAAAGAACAGAGGAAAGAAGG - Intergenic
907703233 1:56810051-56810073 GAGAAAGAGGAGGGGGAAGAGGG + Intronic
907834781 1:58098491-58098513 GAGCATCAGCAGAGGGTTGGAGG - Intronic
908060527 1:60343411-60343433 GAGCATGTGGAGAGGGAAAAGGG + Intergenic
908605123 1:65790448-65790470 GAGCAGAAGCAGAAGGAAGAAGG - Intergenic
909340745 1:74528282-74528304 GAGCCTGAGCAGGGTGAGGAGGG + Intronic
909456370 1:75854316-75854338 CAGCATAGGCAGAGTGAAGATGG - Intronic
909833911 1:80230271-80230293 GAGCAGGAGGAGAGAGAAGGGGG + Intergenic
910163061 1:84294456-84294478 GAGCATGTGAAGAGGAAAAAGGG - Intergenic
910396584 1:86800082-86800104 AAGCATGAGTAGAGAGAAGGGGG - Intergenic
910682680 1:89883412-89883434 AAGCATGACCAGAGGGTAAAGGG + Intronic
910921395 1:92351570-92351592 GACCAAGAGCAAAGGGAAGAGGG - Intronic
911196000 1:94996375-94996397 GAGGAAAAGCAGTGGGAAGAAGG + Intronic
912322547 1:108727781-108727803 AAGCAGGAGCAGAGGGAAAATGG - Intronic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
912566754 1:110592903-110592925 GAGTATGAGCACAGGGAAGTCGG - Intergenic
912755303 1:112319935-112319957 GAGCATGAGGACAGGTAAGAAGG + Intergenic
912938451 1:114024078-114024100 GAGAATGAGGTGAGGGAGGAGGG + Intergenic
912976492 1:114335692-114335714 TAGCATGAGCAAAGGCATGAAGG + Intergenic
913387697 1:118277772-118277794 GGGTTAGAGCAGAGGGAAGAAGG + Intergenic
915069083 1:153251260-153251282 GGGCATGAGGAAGGGGAAGAGGG - Intergenic
915196308 1:154192557-154192579 GAGCTTGGGCACAGGGAAGAGGG + Intronic
915300857 1:154950901-154950923 GGGCCTGGGCAGAGGGAAGATGG - Intronic
915657654 1:157375067-157375089 GGGAATGTGCAGAGGGAAGGAGG - Intergenic
916756951 1:167780180-167780202 GAAAATGAGCAAAGGGTAGATGG + Intronic
917017003 1:170543424-170543446 GGGCAGGAGAAGAGGGAAGAAGG + Intronic
917240355 1:172941385-172941407 GAGCATGAGCAGTGGCAATGTGG + Intergenic
917278349 1:173355089-173355111 GAGCATGAGCCAAGGGATGTGGG - Intergenic
917374364 1:174333163-174333185 GAGAATGAGGAGAGGGTAGATGG + Intronic
917505190 1:175621035-175621057 GAGCGATAGCAAAGGGAAGAGGG - Intronic
917530592 1:175831490-175831512 GAGAGTGGGCTGAGGGAAGATGG + Intergenic
917701818 1:177589469-177589491 GAGCATGGACCAAGGGAAGATGG + Intergenic
918106741 1:181421983-181422005 GGGCAGGAGCACAGGGAACAAGG - Intronic
918135566 1:181670917-181670939 GAGCAAGAGCTGAAGGAGGAAGG + Intronic
918526422 1:185469582-185469604 GAGCATGAAGATAAGGAAGAAGG + Intergenic
919135924 1:193507814-193507836 GAGCCTGAGCAGAGACAAGAGGG - Intergenic
919859787 1:201731919-201731941 CAGCATGAGCACAGGGCAGCTGG - Intronic
920277930 1:204821782-204821804 GAGAATGAACAGACCGAAGAAGG - Intergenic
920373505 1:205493977-205493999 GAGCAGAAGCAGAGGAGAGAGGG - Intergenic
921300459 1:213746680-213746702 TAGCAGGAGGAGAGAGAAGATGG + Intergenic
921334778 1:214075341-214075363 GGGGATGAGCAGAGGAAAGGTGG - Intergenic
921351657 1:214242340-214242362 CAGCAAGAGCAGGAGGAAGAAGG - Intergenic
922002460 1:221493880-221493902 GAGCAAGAGCAGAGTGAGCAAGG - Intergenic
922165951 1:223115982-223116004 CAGTAAGAGCAGAGAGAAGAGGG - Intronic
922213268 1:223501218-223501240 GAGGAGGAGGAGAGGGAGGAGGG - Intergenic
923052010 1:230395846-230395868 GAGCATGAAGAGGGGGAGGAGGG - Intronic
923548741 1:234944219-234944241 GAGAATGAGAATAGGGAAGTAGG + Intergenic
923877275 1:238062833-238062855 GAGAAGGAGCAGAGGAAGGATGG - Intergenic
923907504 1:238401778-238401800 CAGCCGGAGCAGGGGGAAGAGGG + Intergenic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
1062841929 10:679132-679154 GAGCATGGGCGCAGGGAGGATGG - Intronic
1062841993 10:679320-679342 GAGCATGGGCGCAGGGAGGATGG - Intronic
1062968273 10:1626687-1626709 GGCCATGGGCAGAGGGAAGGTGG + Intronic
1063688259 10:8258908-8258930 TAACTAGAGCAGAGGGAAGAAGG + Intergenic
1064469605 10:15622276-15622298 GAGAGTGAGAAGTGGGAAGAAGG - Intronic
1064506409 10:16035046-16035068 GCTCAAGAGCAGAGTGAAGAGGG + Intergenic
1065707490 10:28484172-28484194 GACCAAGAGCAGAAGAAAGAAGG + Intergenic
1066047470 10:31605701-31605723 GAGAAGCAGCAGAGGGTAGAAGG - Intergenic
1066055952 10:31680203-31680225 GTGTATGACCAGAGGGAAGAGGG + Intergenic
1066448496 10:35506562-35506584 CAGCATGAAGAAAGGGAAGAAGG - Intronic
1067169603 10:43895816-43895838 AAGCATGAGCAGAGGGATAAGGG + Intergenic
1067577089 10:47415729-47415751 GAGAATGAGGAGTGGGCAGATGG + Intergenic
1069109320 10:64425754-64425776 ATGCATGGGCAGTGGGAAGATGG + Intergenic
1069455519 10:68550964-68550986 GAGCAGGAAGAGAGAGAAGATGG + Intergenic
1069667388 10:70172009-70172031 CAGGATGAGCGGAGGGTAGAGGG - Intergenic
1070159652 10:73858531-73858553 GAGGGTGGGCAGAGGGAAGGGGG - Intronic
1070409792 10:76129231-76129253 GAGCTTGAGCAAAGTGAAGGGGG - Intronic
1070433500 10:76364590-76364612 GGGCATGGGAAGAGGGAAAAAGG + Intronic
1070697737 10:78575192-78575214 GAACATGAGCAGAGGAGAGAGGG + Intergenic
1070949634 10:80420440-80420462 GAGATTGAGAAGAAGGAAGAAGG - Intronic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1071397433 10:85237842-85237864 GAGAATGGGCAGAGGCAAGATGG + Intergenic
1071531297 10:86391991-86392013 GAGAGGGAGCAGAGGGAAGCAGG + Intergenic
1072324523 10:94284628-94284650 GACCATGCACTGAGGGAAGATGG + Intronic
1072591322 10:96831391-96831413 GAGAACGAGAAGAGAGAAGATGG - Intergenic
1072727107 10:97821622-97821644 GAGCCTGAGCTGAGGGCATATGG - Intergenic
1072943752 10:99790932-99790954 AAGCATGAGGGGAGGGGAGATGG + Intronic
1073284669 10:102380467-102380489 GACCATGAGAATAGGAAAGAGGG - Intronic
1073563860 10:104519085-104519107 TGGAAGGAGCAGAGGGAAGAGGG - Intergenic
1073805554 10:107093840-107093862 GAGCTGGAGCAGAGTGAAGGAGG - Intronic
1074076089 10:110127088-110127110 GAGAATGGGGAGAGGGAAAAAGG - Intronic
1074142865 10:110690548-110690570 TAGCAGGAGCTGGGGGAAGAGGG - Intronic
1074349412 10:112721232-112721254 GACCATGAGAAGTTGGAAGATGG - Intronic
1075798225 10:125135878-125135900 GAGCAGGGTCAGAGGGCAGAAGG - Intronic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1076055634 10:127370057-127370079 GAGCATGTGCAGGGGGAGGTGGG - Intronic
1076279057 10:129229959-129229981 GAGCAGCAGGAGAGGCAAGAGGG - Intergenic
1077057440 11:601674-601696 GAAGAAGAGAAGAGGGAAGAAGG + Exonic
1077285027 11:1761799-1761821 GCGCAGGTGCAGAGGGAGGACGG - Intronic
1077531312 11:3096954-3096976 GAGGAGGAGAAGAGGAAAGAGGG + Intronic
1077531322 11:3096986-3097008 GAGGAGGAGAAGAGGAAAGAGGG + Intronic
1077531356 11:3097107-3097129 GAGGAGGAGGAGAGGAAAGAAGG + Intronic
1077660532 11:4064671-4064693 GAACTTGGGAAGAGGGAAGAGGG + Intronic
1077868627 11:6243096-6243118 GAGCAGGAACAGAGGGAAGGGGG - Intronic
1078535906 11:12173703-12173725 TAGCAGGGGCTGAGGGAAGAAGG - Intronic
1078604306 11:12761638-12761660 GAGGGTGGGCAGAGGGATGATGG + Intronic
1078707411 11:13758543-13758565 CAGCTAGATCAGAGGGAAGATGG - Intergenic
1079121661 11:17689588-17689610 GGGCAAGGGCAGAGGCAAGAGGG - Intergenic
1080016572 11:27513259-27513281 GAGCATGAACCAAGGGAAGCTGG + Intergenic
1080032862 11:27680277-27680299 GAGAATGAAAAGAGGGAGGAAGG + Intronic
1080305548 11:30831087-30831109 GATCCTGAGCAGAGGGAATGAGG + Intronic
1083275055 11:61592188-61592210 GGGCTGGAGCAGAGGGAGGATGG + Intergenic
1083679483 11:64344582-64344604 GAGCATGACCAGAGGCTGGAAGG + Exonic
1083859374 11:65411813-65411835 GAGCACTAGCAGGAGGAAGACGG - Exonic
1084225337 11:67711715-67711737 GAACAGGCGCAGAGGGGAGACGG - Intergenic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1084617252 11:70244794-70244816 GAGGAGGAGGAGAGGGAAGGAGG + Intergenic
1084705920 11:70815896-70815918 GAGCATGTGCAGAGGGACAGGGG + Intronic
1084730665 11:71071484-71071506 GAGCATCAGCAGAGAAAACAGGG + Intronic
1084974737 11:72790532-72790554 GAGCAGGGGCTGGGGGAAGAGGG - Intronic
1085196680 11:74676874-74676896 GAGCTGGAGCAGAGAGGAGACGG - Intergenic
1085410028 11:76285406-76285428 CAGCATGAGGAAAGGCAAGATGG - Intergenic
1085704322 11:78772407-78772429 GAGCAGCAGCAGAGAGGAGATGG - Intronic
1086598188 11:88600260-88600282 GAGAAGGAGCAGGAGGAAGAAGG - Intronic
1086890025 11:92246554-92246576 GAGGAGGAGAAGAAGGAAGAAGG + Intergenic
1087152618 11:94872355-94872377 AAGCATGAGCAAAGGGAACTGGG - Exonic
1087272397 11:96124756-96124778 GGGCATGAGAGGAGGGAAGAAGG + Intronic
1088199888 11:107320931-107320953 GAGCATGAGCAGAGGGACTATGG + Intergenic
1089114123 11:116080374-116080396 AAGGAACAGCAGAGGGAAGAGGG - Intergenic
1089342806 11:117770957-117770979 GAGCAGGAGAGGAGAGAAGATGG + Intronic
1089398842 11:118152925-118152947 GAGCAGGAGCGGGAGGAAGACGG + Intergenic
1089590304 11:119536026-119536048 GAGCAGGAGAAGAGAGAAGAGGG + Intergenic
1090210957 11:124920971-124920993 GAGCATGCGCAGACGGAGGCGGG - Exonic
1090254422 11:125273362-125273384 GAGGATGGGCAGATGGGAGAAGG + Intronic
1090329632 11:125920850-125920872 CAGCAGGAGCAGAGAGGAGAGGG + Intronic
1090342300 11:126034960-126034982 GAGGATGAGCAGGAGGAATATGG + Intronic
1090402850 11:126460106-126460128 GAGCAGGAGGAGGGGGAAGGGGG + Intronic
1090427411 11:126618121-126618143 GAGCAGGAGGAGAGGGGAGTGGG - Intronic
1090590567 11:128262544-128262566 GAGGATGCACAGAGAGAAGACGG - Intergenic
1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG + Intergenic
1090979962 11:131710994-131711016 GAGAATAAGGAGAGAGAAGAAGG - Intronic
1091412016 12:248032-248054 AAGCAGGAGGAGAGGGAAGGGGG + Intronic
1091992527 12:4967476-4967498 GAGGATGAGTAGAAGGAAGAGGG - Intergenic
1092884781 12:12915605-12915627 GAGAAGGAGGAGAAGGAAGAAGG - Exonic
1093037301 12:14344781-14344803 AAGAATGGGCAGAGGGAAAAGGG - Intergenic
1093368686 12:18337614-18337636 GAGCTGGAGCAGAGGGAGGCGGG + Intronic
1094356127 12:29579627-29579649 GAAGATTAGGAGAGGGAAGAGGG + Intronic
1095279075 12:40328135-40328157 GGGTATGTGTAGAGGGAAGACGG + Intronic
1095296128 12:40529728-40529750 GAACAGGAGGAGAGGAAAGACGG - Intronic
1095578194 12:43763705-43763727 GAGTATGAGGGGAGGGAAAATGG - Intronic
1096054109 12:48636646-48636668 GAGCAAGTGCAGAGGGAAGGGGG + Intergenic
1096452512 12:51756186-51756208 CAGCATGAGCAGGGTGACGAGGG - Intronic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097021700 12:56025494-56025516 GAGAATGAGCTGTGGGGAGATGG - Intronic
1097092924 12:56521850-56521872 GAGCAGGAGGAGAGAGATGAAGG - Intergenic
1097751579 12:63360253-63360275 GGAGATTAGCAGAGGGAAGATGG - Intergenic
1098184727 12:67884002-67884024 GAGGATAAGCAGGGGTAAGAAGG - Intergenic
1098346844 12:69514418-69514440 GAGCAGAAGCAGAGAGCAGAAGG - Intronic
1098400504 12:70070338-70070360 GAGGATGTGCAAAGAGAAGAGGG - Intergenic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1099163943 12:79278505-79278527 CAGCAAGAGCAGAGCTAAGAGGG + Intronic
1099286442 12:80718139-80718161 GAGCAGCAGCAAAGGGAAGAGGG - Intronic
1099302578 12:80916399-80916421 GAGCTGGAGCAGAGGGAACAAGG - Intronic
1099860148 12:88216128-88216150 CAGCAAGAGCAGCGGTAAGAGGG + Intergenic
1100091820 12:90982439-90982461 GAGGATGAGAAGAGAGAAGTTGG - Intronic
1100253523 12:92858024-92858046 GAGAAGGAGCAGCGGCAAGATGG - Intronic
1100383713 12:94085953-94085975 GAGGATGTGCATAGGGAAGATGG + Intergenic
1100420232 12:94425120-94425142 GAGCAGGAGGAGAGAGATGAAGG + Intronic
1100449927 12:94696066-94696088 GAGCAGCAGCAGGGGGAAGGAGG + Intergenic
1100550763 12:95644462-95644484 GAGGAGGAGCAGGAGGAAGAGGG - Intergenic
1100572091 12:95852441-95852463 GAGCCTGAGCAGGAGGAGGAAGG - Intergenic
1100844956 12:98648341-98648363 GAGAAAGATCTGAGGGAAGATGG + Exonic
1100978163 12:100143091-100143113 GAACACCAGCAGAGGGAAGGAGG - Intergenic
1101510071 12:105384983-105385005 GAGCATGAGCAGTGGGGATGAGG + Intronic
1101648881 12:106656677-106656699 GAGAATGAGGAGAAGGGAGATGG - Intronic
1102465338 12:113127780-113127802 GGACATGGGCAGAGGGAGGAGGG - Intronic
1102747785 12:115265091-115265113 GAGCATGACCAATGGGTAGATGG + Intergenic
1103898741 12:124292265-124292287 TAGGAAGGGCAGAGGGAAGAAGG - Intronic
1104391897 12:128397851-128397873 GAGGCTGAGCAGAGGGGAGGTGG - Intronic
1105519177 13:21116242-21116264 GAGCAGGACCACAGGGAGGAAGG - Intergenic
1105943249 13:25169993-25170015 CAGCTCGAGCAGCGGGAAGAAGG - Exonic
1106668827 13:31882985-31883007 GAGAATGAGCTGAGTGAAGGGGG - Intergenic
1106777181 13:33019767-33019789 GAGAAGGAGAAGAGGGGAGAGGG + Intronic
1107015476 13:35705310-35705332 GGGCATGAGTAGAGGGAGGAAGG + Intergenic
1107683821 13:42877109-42877131 GAGCAGGAGAAGAGAGAAAAAGG + Intergenic
1107761944 13:43688763-43688785 GAGCAGGGTCAGAGGGAAGGAGG + Intronic
1108426482 13:50306927-50306949 GGGGATTAGCAGAGGGAGGAAGG - Intronic
1108439460 13:50435833-50435855 AAGCTTGATCAGAGTGAAGAAGG + Intronic
1108775350 13:53759099-53759121 AAGAATGAAAAGAGGGAAGAAGG - Intergenic
1109188590 13:59299184-59299206 GAGGAGGAGCAGGGAGAAGAGGG + Intergenic
1110234136 13:73198566-73198588 GATCATGAACAGAGGACAGATGG - Intergenic
1110428152 13:75392601-75392623 GAGGAGGAGGAGGGGGAAGAAGG - Intronic
1110627412 13:77666873-77666895 GAGGAGGAGCAGAAGGAAGTTGG + Intergenic
1111405002 13:87792494-87792516 AATCATGAGCAAGGGGAAGAAGG + Intergenic
1111822973 13:93235576-93235598 GAGGATGAGAGGAGTGAAGAAGG + Intronic
1111909625 13:94296080-94296102 GTGCTAGGGCAGAGGGAAGAGGG + Intronic
1112616798 13:101014783-101014805 GCACTTGAGCAGAGGGAAGGAGG - Intergenic
1113281236 13:108790061-108790083 TAGCATAAGCAAAGGCAAGAAGG + Intronic
1113301504 13:109026755-109026777 GAACTTGATCTGAGGGAAGATGG - Intronic
1113574935 13:111388660-111388682 GACAATGAGGAGAGGGAGGAGGG - Intergenic
1113669453 13:112165765-112165787 GAGGAGGAGGAGAAGGAAGAGGG - Intergenic
1113675690 13:112205535-112205557 GTGCACCCGCAGAGGGAAGAGGG + Intergenic
1114268259 14:21085664-21085686 GAGGAAGAGCAGAGGGCAGCGGG - Intronic
1114454787 14:22847445-22847467 GAGCAAGAGGAGAGGGATGTCGG + Exonic
1115480013 14:33851433-33851455 GAGGATGAGCAGAGGTAGGGGGG + Intergenic
1115762452 14:36589015-36589037 GACCACGAGCAGAGGAAAGCTGG - Intergenic
1115952090 14:38732808-38732830 GTGGTTGAGCAGAGGGAAAAAGG + Intergenic
1116372148 14:44149859-44149881 GAGCTTGAGGAGAGGTATGAAGG - Intergenic
1117079101 14:52133083-52133105 GAGGCTGAGCTGAGGGAGGAGGG + Intergenic
1117288526 14:54310305-54310327 GGGCATGAGCACAGAGAAGAGGG - Intergenic
1117320331 14:54616175-54616197 GTGCATGAGCAGAGGGAGCAAGG - Intronic
1118171781 14:63395727-63395749 GAGGAGGAGCAGAGGGAAAAGGG + Intronic
1118225773 14:63897783-63897805 GAGCAGGAGCAGGGGGAGCATGG - Intronic
1118916935 14:70115592-70115614 GTGCCTGAGGAGAGGGACGATGG + Intronic
1119096002 14:71831694-71831716 GAGCATGGGCACAAGGAAGAAGG + Intergenic
1119118193 14:72046637-72046659 GAGGAAGAGTAGAAGGAAGAAGG - Intronic
1119199038 14:72739590-72739612 GGGCATGAGCCCAGGGAGGATGG + Intronic
1119205498 14:72790943-72790965 CACCAGGAGCAGAGGGAAGAGGG - Intronic
1119557789 14:75566908-75566930 GGGGCTGAGCAGAGGGAAGGAGG + Intergenic
1119734188 14:76970988-76971010 GGGCGTGAGCTGAGGGAACAGGG - Intergenic
1119871351 14:78020629-78020651 GAGCAAGGGAAGTGGGAAGAAGG + Intergenic
1119907970 14:78322749-78322771 AAGCACGAGCAGAGATAAGACGG - Intronic
1119922209 14:78456966-78456988 GAGAAGGAGGAGAAGGAAGAAGG - Intronic
1119985537 14:79132981-79133003 GAGCATGATCTTAGGCAAGATGG + Intronic
1120111085 14:80557752-80557774 GAGTATGAAGAGAGGAAAGATGG - Intronic
1120113734 14:80589120-80589142 AAGCATGAGCCAAGGGATGAAGG + Intronic
1120194448 14:81466929-81466951 GAGCTTGGGCAGAGGGCAGAGGG + Intergenic
1120791746 14:88590371-88590393 GAGCCAGAGCAGAGGGAGGCAGG - Intronic
1121267006 14:92610713-92610735 CAGCATGAGCAGAGGCAAGGAGG + Intronic
1121604470 14:95230503-95230525 GGGCATGAGGAGATGGGAGAGGG + Intronic
1122238036 14:100344070-100344092 GACCGTGGGGAGAGGGAAGAGGG - Intronic
1122412278 14:101531758-101531780 GAGCCAGGGCAGAGCGAAGAAGG + Intergenic
1123874443 15:24609599-24609621 GAGCATGAGAAGAGGGCTGTGGG + Intergenic
1124475457 15:30029398-30029420 GGGAAGGAGGAGAGGGAAGATGG - Intergenic
1124639633 15:31389476-31389498 GAGAAGGTGCAGAGGGTAGAGGG - Intronic
1125726526 15:41871123-41871145 GAGCAGGAGCTGTGGGAAGATGG - Intronic
1125756561 15:42069348-42069370 GAGCATGTTCAGAGGAAAGCTGG + Intronic
1126216885 15:46165706-46165728 GAGGATGGACAAAGGGAAGATGG + Intergenic
1126538447 15:49794906-49794928 GAGCAAGAGCTGAGAGAAGTAGG + Intergenic
1126644030 15:50857005-50857027 AAGAAAGAGCAGAGGGAAGATGG + Intergenic
1127165935 15:56244540-56244562 CAGCATGAGCAAAGGCACGAAGG - Intronic
1127185943 15:56480891-56480913 AAGAATGGTCAGAGGGAAGAGGG - Intergenic
1127341090 15:58044824-58044846 TTGGATGAGCAGAGGGAAAAGGG + Intronic
1127395665 15:58542171-58542193 GTGGATGAGGAGAGGGGAGAAGG - Intronic
1127460647 15:59195404-59195426 CATCTTGAGCAGAGGGAAAAAGG + Intronic
1127967027 15:63930146-63930168 GAGCAAGAGGAGAGGCAAGGGGG - Intronic
1128095660 15:64952740-64952762 GAGGAGGAGAAGAGGAAAGAAGG - Intronic
1128586277 15:68853002-68853024 GAGCCCGAGCAGAGTGAGGAGGG + Intronic
1129272568 15:74427183-74427205 CAGCATGATCTGAGCGAAGATGG - Intronic
1129665312 15:77576322-77576344 GAGGAGGAGGAGGGGGAAGAGGG + Intergenic
1130162213 15:81413439-81413461 CAGCATAAGCTGAGGGGAGATGG - Intergenic
1130225956 15:82058687-82058709 GAGGAGGAGAAGAGGGAGGATGG - Intergenic
1130379721 15:83360986-83361008 GGGCAGCAGGAGAGGGAAGAAGG - Intergenic
1132072116 15:98787431-98787453 GAGCGTGAGCAAAGGGAAAATGG + Intronic
1132467214 16:82893-82915 GAGCAAGAGAAGAGGCAGGATGG + Intronic
1132696943 16:1206250-1206272 GAGCATGAGCAGCGTGCAGAAGG - Exonic
1134122798 16:11596693-11596715 GAGCAGGGGGAGAGGGAGGAGGG + Intronic
1134369489 16:13609760-13609782 GAGCAGGAGCAGATGGGGGAAGG + Intergenic
1135241497 16:20810801-20810823 GAGCCTAAGCAGAGTCAAGAGGG - Intronic
1136296833 16:29308752-29308774 GGGCATGAGCTGAGGGGACACGG - Intergenic
1136553554 16:30994803-30994825 GAGCAGGAGATGAGGGGAGAGGG - Intronic
1136607913 16:31348889-31348911 GGTCATGAGCAAAGGGAAGAGGG - Intergenic
1137005965 16:35274576-35274598 GCGCATGAGCAGAGCCAAGTGGG + Intergenic
1137509880 16:49089930-49089952 GAGGAAGAGCAGAGAGGAGATGG - Intergenic
1137741814 16:50783905-50783927 GGGCATGGGGAGAGGGAAGTGGG + Intronic
1137931022 16:52587879-52587901 GTGCATGAACAGAGTGAAGGTGG + Intergenic
1138217177 16:55214553-55214575 GAGGATGAGGAGAGGGGAGAGGG + Intergenic
1138470785 16:57234113-57234135 GAGCATGAGAAAACGGGAGAGGG - Intronic
1138576145 16:57908479-57908501 GAGGATGAGAAGGTGGAAGAAGG - Intronic
1139192311 16:64879056-64879078 CAGCAGGAACAGAGGGAAAAAGG - Intergenic
1139328467 16:66169600-66169622 GAGGAGGAGGAGAGGGAGGAAGG + Intergenic
1139476037 16:67203015-67203037 GGGCATGGGCAGGGGGCAGAGGG + Intronic
1139485306 16:67252885-67252907 GAGCTTGAGGAGAAGGGAGAGGG - Intronic
1139955910 16:70692898-70692920 GAGCATGAGCAGGCCGTAGAGGG + Exonic
1140063011 16:71587778-71587800 GGGCATGGCCAGAGGCAAGAGGG - Intergenic
1140162208 16:72508809-72508831 GGGCATGAGCAAATGGAAGGGGG + Intergenic
1140943608 16:79747090-79747112 GAGAAGGAGACGAGGGAAGAGGG + Intergenic
1141364695 16:83431944-83431966 GATTTTGAGCAGAGGAAAGAGGG + Intronic
1141760375 16:86025230-86025252 GAGCATGAGCAGGTGGCATATGG - Intergenic
1142421022 16:89970182-89970204 GGGGAGGAGGAGAGGGAAGATGG - Exonic
1142553514 17:755961-755983 GAGCAGGAAGGGAGGGAAGAGGG - Intergenic
1142564017 17:827825-827847 GGGCAGCAGCAGAGGGAAGAGGG + Intronic
1142881084 17:2883118-2883140 GAGCTTGAACACAGAGAAGATGG - Intronic
1143099159 17:4495731-4495753 GAGGATGGGCAGAGGGCAGATGG + Intergenic
1143100607 17:4502748-4502770 CAGCTTGAGCAGAGGCATGAAGG - Intronic
1143965687 17:10755266-10755288 GAGCTGTAGCTGAGGGAAGAGGG - Intergenic
1144161752 17:12566883-12566905 TAGCATGAGCTGGGGAAAGAAGG - Intergenic
1144478417 17:15609289-15609311 GAGAGGGAGCAGAGGAAAGAGGG - Intronic
1144573765 17:16416385-16416407 GAGCAGGATCAGAAAGAAGAAGG - Intronic
1144574927 17:16423403-16423425 GAGCATGAGGAGTAGGCAGATGG + Intronic
1144620246 17:16814362-16814384 CAGCATGGGCATGGGGAAGAGGG - Intergenic
1144777231 17:17791070-17791092 GAGCTGGAGCAGAGGGAAAGCGG + Intronic
1144919873 17:18754422-18754444 GAGAGGGAGCAGAGGAAAGAGGG + Intronic
1145062435 17:19741614-19741636 GAGCAGGCCCAGAGGGGAGAAGG - Intronic
1145827590 17:27888834-27888856 TAGCTTGAGCAGAGCGAAAATGG - Intronic
1145898418 17:28474196-28474218 AAGCAGCAGCAGAGTGAAGAGGG + Intronic
1145916280 17:28575913-28575935 GAGGATGAGAAAAGGGAAGCTGG - Intronic
1146109544 17:30075714-30075736 GAGCCTGAGCAGAGCGAGGAGGG - Intronic
1147571628 17:41575241-41575263 CAGCATGGGCATGGGGAAGAGGG - Intergenic
1148877303 17:50697472-50697494 GAACAGGGGAAGAGGGAAGAAGG + Intronic
1148994804 17:51700430-51700452 GAGCATGAGCAAACGGAGGTGGG - Intronic
1149304630 17:55335827-55335849 GGGAGGGAGCAGAGGGAAGAGGG - Intergenic
1149427599 17:56570123-56570145 GACTATGAGAAGAGGGAGGAAGG + Intergenic
1149564416 17:57630939-57630961 GGGGATGAGGAGAGGGCAGAGGG - Intronic
1149621756 17:58050585-58050607 GACCACGATTAGAGGGAAGAGGG + Intergenic
1149636709 17:58176894-58176916 AAGCATGAGGAGTGGGGAGAGGG + Intergenic
1149798932 17:59548437-59548459 GAACAGAAGCAGAGGGAAGCAGG - Intergenic
1150143996 17:62752772-62752794 GAGCAAAAGCAAAAGGAAGAGGG - Intronic
1150586416 17:66522427-66522449 GAGAATAGGCAGGGGGAAGAGGG + Intronic
1151174201 17:72273795-72273817 AGCCAGGAGCAGAGGGAAGAGGG + Intergenic
1151245436 17:72790885-72790907 GACCCTGAGCAGAAGGAAGAAGG + Intronic
1152061217 17:78077025-78077047 GAACATGTGCAAAAGGAAGAGGG - Intronic
1152302230 17:79501843-79501865 GAGAAAGAGAAGAGGGAAAACGG + Intronic
1152360188 17:79829444-79829466 CAGCAGGAACTGAGGGAAGAAGG + Intergenic
1152430979 17:80248205-80248227 GAGCATGAGCAGAGACACCAGGG - Exonic
1153623337 18:7000374-7000396 GAAAAACAGCAGAGGGAAGATGG + Intronic
1155156584 18:23162826-23162848 GAGTATAAGCAGCGGGAAGAGGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155670932 18:28370271-28370293 AGGCCTGAGCAGAAGGAAGAAGG + Intergenic
1156037204 18:32778135-32778157 GAGAAAGAGCAGAGAGAACAAGG + Intergenic
1156111726 18:33735668-33735690 AGGCAAAAGCAGAGGGAAGAAGG - Intronic
1156658265 18:39313457-39313479 CAGCAAGAGGAGAGGGGAGAAGG - Intergenic
1157488680 18:48107420-48107442 GAGGAAGAGGAGAGGGAGGAGGG + Intronic
1157891565 18:51423126-51423148 GAGCAGGAGCAGAGTCCAGAAGG - Intergenic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158516896 18:58138322-58138344 GAGGAGGAGGGGAGGGAAGAAGG - Intronic
1158885041 18:61819039-61819061 CAGCATGAGCAAAGGAAAGAAGG + Intronic
1159434781 18:68401905-68401927 TTGCTTGAGCAGAGTGAAGAAGG + Intergenic
1159484519 18:69037634-69037656 GAACATGAGCAAAGGCATGAGGG + Intronic
1159504967 18:69324743-69324765 GAGGAGGAGAAGAGGGAACAAGG + Intergenic
1159995801 18:74962677-74962699 CAGCACCAGGAGAGGGAAGAGGG - Intronic
1160062827 18:75548427-75548449 GAGCAAGAGCCGAGGAGAGAAGG - Intergenic
1160216318 18:76935633-76935655 GAGCTTGCACAGAGGGAAGACGG - Intronic
1160236955 18:77093291-77093313 GAGCTGCAGCAGAGGGAAGGCGG + Intronic
1160840543 19:1145132-1145154 GACTAGGAGCAGGGGGAAGAGGG + Intronic
1161151456 19:2712272-2712294 GAGCAGGAGCACAGGGGAGGAGG - Intergenic
1161321282 19:3642804-3642826 GAGAATGGGCAGAGAGCAGAGGG + Intronic
1161381658 19:3968664-3968686 AAGCATGAGAAGGGGGAGGAGGG + Intronic
1161477847 19:4496259-4496281 GCGCTGGAGCAGTGGGAAGAGGG - Intronic
1161713253 19:5861835-5861857 GAGCAAGAGATGAGGGAAGCTGG + Intergenic
1161769184 19:6222210-6222232 GAGCAGCACCAGAGGGGAGAAGG - Exonic
1162032193 19:7922367-7922389 GGGCAGGAGCAGAGGGATCAAGG + Intronic
1162175826 19:8829484-8829506 GAACTTGATCAGAGGGAACAGGG - Intronic
1162412356 19:10514193-10514215 GAGCAACAGCAGCAGGAAGAGGG + Exonic
1162543025 19:11309607-11309629 GAGCATGATCACTGGGATGAGGG - Intronic
1163350755 19:16775371-16775393 AAGCAAAAGCAGAGGCAAGAGGG + Intronic
1163676872 19:18659820-18659842 GATCAGGAGCAGAGGGAGGTGGG - Intronic
1163713006 19:18857954-18857976 GAGCGTCAGCAGAGTGAAAAAGG - Intronic
1164149713 19:22540797-22540819 GAGGAGGAGGAGAGGGGAGAGGG + Intergenic
1164250118 19:23468626-23468648 GAGAAAGAGGAGAGGGAAAAAGG - Intergenic
1164465401 19:28483362-28483384 GAGAAAGAGGAGAGAGAAGAGGG - Intergenic
1164667915 19:30053631-30053653 GAGGATGGGGAGAGGGAAGCAGG + Intergenic
1166137452 19:40786176-40786198 GAGCATGGGCAGAGGGCTCAGGG + Intronic
1166192335 19:41183310-41183332 CAGGATGAGCAGTGGGATGAGGG + Intergenic
1166197093 19:41214245-41214267 GGGCAGGAGTAGAGGGAAGGTGG - Intergenic
1166932499 19:46309373-46309395 GAACTTGGGCAGACGGAAGAGGG - Intronic
1167516726 19:49927867-49927889 GTGCATGAGAAGGGGCAAGATGG + Exonic
1167530768 19:50014805-50014827 AAGTATGAGCAGAGGAATGATGG + Intronic
1167608138 19:50492703-50492725 GAGGAGGAGGAGAAGGAAGAAGG + Intergenic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167867152 19:52337497-52337519 GAGAAGGAATAGAGGGAAGAGGG + Intronic
1167889633 19:52528924-52528946 GAGAAGGAATAGAGGGAAGAAGG + Intronic
1167903111 19:52637103-52637125 GAGAAGGAATAGAGGGAAGAAGG - Intronic
1167964361 19:53131672-53131694 GAGAAAGAATAGAGGGAAGACGG - Intronic
1168182247 19:54669879-54669901 AATCTTGAGCAAAGGGAAGAAGG - Exonic
925128696 2:1479220-1479242 GGGGTTGAGCAGAGGGGAGAAGG - Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925201090 2:1968243-1968265 GGGCATGCGGAGAGGGCAGAGGG - Intronic
925662785 2:6220601-6220623 GAGCCTGGGCAGATGGGAGAAGG + Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
925994627 2:9281993-9282015 GAGCATGAGCAGAGGGAAGAAGG - Intronic
926210537 2:10866167-10866189 CAGGAGGAGGAGAGGGAAGAGGG - Intergenic
927103429 2:19805237-19805259 GAGGATGTGAGGAGGGAAGAAGG + Intergenic
927182715 2:20458450-20458472 GAGGGTGAGCAGAAGCAAGATGG + Intergenic
927595330 2:24391807-24391829 GAGTATGAAGAGAGGGAAGGAGG - Intergenic
927697712 2:25249372-25249394 GAGCATGTGCTGGGGGGAGATGG - Intronic
927703122 2:25280468-25280490 GAGAGTGAGAACAGGGAAGAAGG - Intronic
929587488 2:43125623-43125645 GCCCATCAGCAGAGGGAAAAAGG + Intergenic
929868314 2:45736958-45736980 GGGAATGAGCAGATGGAAGAGGG + Intronic
930032658 2:47068052-47068074 GAGAATGAGCTGAGGGACGAGGG + Intronic
930233015 2:48861600-48861622 GAGCATGAGCAAAGGCACAACGG - Intergenic
930301616 2:49622650-49622672 GATCATGAGCCAAGGGATGAAGG + Intergenic
930463026 2:51708078-51708100 AAGTATAAGAAGAGGGAAGAAGG - Intergenic
931260736 2:60616183-60616205 GAACATGAGCAGAGGCACCAAGG - Intergenic
931423754 2:62152109-62152131 GGAGGTGAGCAGAGGGAAGATGG - Intergenic
932060826 2:68495905-68495927 GAGCCAGAGCAGTGGGAATATGG + Intronic
932731607 2:74225867-74225889 GAGCATGAGCAGAGTGACCCTGG - Intronic
932887690 2:75561706-75561728 AAGCTTGGACAGAGGGAAGACGG + Intronic
932925987 2:75975133-75975155 AATCATCAGCAGAGGGAAGAGGG + Intergenic
933250553 2:80024453-80024475 CAGCATGAGCAAAGGCATGAAGG + Intronic
933841051 2:86285901-86285923 GGGCTCAAGCAGAGGGAAGATGG + Intronic
934534083 2:95118467-95118489 TGGCATGGCCAGAGGGAAGATGG - Intronic
934605224 2:95689995-95690017 GCGCCTGAGCAGAGTGATGATGG - Intergenic
934962314 2:98687503-98687525 GAAAGTGAGAAGAGGGAAGAAGG - Intronic
935740191 2:106140548-106140570 GGGCACCAGGAGAGGGAAGATGG - Intronic
936537246 2:113321888-113321910 GAGCATGGGCAGAGGGAGGCCGG + Intergenic
936538677 2:113332533-113332555 CAGCCTGAGCAGAGTGATGATGG - Intergenic
936624574 2:114134971-114134993 AACCATAAGCAGAGGTAAGACGG + Intergenic
937046372 2:118854082-118854104 GAGCAGGGGAACAGGGAAGATGG - Intergenic
937466795 2:122139816-122139838 GGGCCAGAGAAGAGGGAAGAAGG + Intergenic
938173788 2:129105676-129105698 GAGGAAGAGAAGAAGGAAGAAGG + Intergenic
938555778 2:132423111-132423133 GGACATGTGCAGAGGGAAAAGGG - Intronic
939024241 2:136993006-136993028 GAGCATGAGTAGAAAGATGAAGG - Intronic
939102094 2:137907094-137907116 GAGCCAGAGTAGAGTGAAGAGGG - Intergenic
939623248 2:144446400-144446422 GGGGATGTGGAGAGGGAAGAAGG - Intronic
940199567 2:151135392-151135414 GAGCGGGAGCAGAGGGAAAGTGG - Intergenic
942228098 2:173834569-173834591 GAGCAGGAGCAGAATGAAAATGG + Intergenic
943151180 2:184115615-184115637 TAGCTTGAGCAGAGGCAACAAGG + Intergenic
944037477 2:195312845-195312867 GAGCAAGAGGAAAGGGAGGAGGG + Intergenic
944142775 2:196475347-196475369 GGGGATGCGCAAAGGGAAGAGGG + Intronic
944226608 2:197354923-197354945 AAGCATGATCAGAGGGTAGAGGG + Intergenic
944277606 2:197856977-197856999 GAGAATGAGGGGTGGGAAGAGGG + Intronic
944496662 2:200314007-200314029 CAGAATGAGCAGAGGGCTGAGGG - Intronic
944634106 2:201657832-201657854 GAGCATGAGCAGGGTGAAGAAGG - Intronic
947042776 2:225942489-225942511 GAGAAGGGGAAGAGGGAAGAGGG + Intergenic
947228978 2:227866494-227866516 GAGGAGGAGGAGAAGGAAGAAGG - Intergenic
947639979 2:231701878-231701900 GGGCATGAGCATAGGTAAGGAGG - Intergenic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
948399742 2:237674966-237674988 GAGCCTGGGCAGTGGGAGGAGGG + Intronic
948556046 2:238812122-238812144 GAGGATGACGAGAAGGAAGAAGG - Intergenic
948939254 2:241187934-241187956 GAGAAGGAGGAGAGGGAAGGTGG + Intergenic
1169071161 20:2731480-2731502 TGGCATGAGCAGAGGTAAGGTGG - Intronic
1169318014 20:4609205-4609227 GAGCAGGGGCAGAAGGAAGAGGG + Intergenic
1169423474 20:5477952-5477974 GAGCTGGGACAGAGGGAAGAAGG - Intergenic
1169424754 20:5487104-5487126 GAGCAAGGACAGAGGGAAGAAGG - Intergenic
1169427525 20:5508326-5508348 GAGCTGGGACAGAGGGAAGAAGG + Intergenic
1169976423 20:11333688-11333710 GAGAAAGAGCAGAGGGAATGGGG + Intergenic
1169993064 20:11525069-11525091 CAGCTGGAGCAGAGGGAATAAGG + Intergenic
1169995064 20:11547039-11547061 GAGAAAGACCAGAGGGAAGAAGG + Intergenic
1170594324 20:17793848-17793870 GAGGCTGAGCAGAGGCAGGATGG - Intergenic
1170887297 20:20352187-20352209 GAGCATGAGAAGAGCAAAGGAGG + Intronic
1170892999 20:20391762-20391784 GTGCAAGGGCAGAGGGCAGAGGG + Intronic
1170947073 20:20900860-20900882 GAGCATGGTCCAAGGGAAGAAGG + Intergenic
1171398440 20:24855909-24855931 GGGCATCAGCACTGGGAAGAGGG - Intergenic
1172027992 20:31962553-31962575 GAACATGAGGAGAGGAAAGAGGG + Intergenic
1172174486 20:32963855-32963877 GAGGAGGAGGAGATGGAAGAAGG - Intergenic
1172518428 20:35551916-35551938 GAGCATGAGCTGAAGCTAGAGGG + Intronic
1172656999 20:36543453-36543475 GGGTTTGGGCAGAGGGAAGAGGG + Intronic
1172693048 20:36803642-36803664 GACTGTGAGCAGTGGGAAGAAGG + Intronic
1172782932 20:37447854-37447876 GAGCACAGGGAGAGGGAAGATGG - Intergenic
1173501769 20:43559081-43559103 GACCATGAAGAGAGAGAAGAGGG + Intronic
1173549722 20:43924129-43924151 GGGGATGAGCATATGGAAGAGGG + Intronic
1173598006 20:44272220-44272242 GAGCAGGTGCAGAGGGCACATGG + Intronic
1173609565 20:44356478-44356500 GTCCCTCAGCAGAGGGAAGACGG + Intronic
1173762823 20:45579038-45579060 GAGCCTAAGCAGGGTGAAGAGGG - Intronic
1173871423 20:46344420-46344442 TAGCATGAGGAGGGGGAAGAGGG - Intergenic
1174150376 20:48482161-48482183 GAGGAGGAGCAGGGGGAAGGAGG + Intergenic
1174443502 20:50575010-50575032 GAGTCTGAAGAGAGGGAAGAAGG + Intronic
1174921482 20:54707143-54707165 CAACATGAGCAGAGGAGAGAAGG + Intergenic
1175357711 20:58382006-58382028 GAAGATGAGCATAGGGCAGAGGG - Intergenic
1175613985 20:60376965-60376987 GTTTATCAGCAGAGGGAAGAAGG + Intergenic
1177259182 21:18706909-18706931 GAGGGTGAACAGGGGGAAGAGGG - Intergenic
1177658708 21:24054329-24054351 GCACATGCACAGAGGGAAGAAGG - Intergenic
1177736209 21:25092930-25092952 GAGCAGGAGCCGGGGGAAGAGGG - Intergenic
1177928351 21:27248196-27248218 GAGGAGGAGGAGAGAGAAGAAGG - Intergenic
1177970591 21:27784721-27784743 GAGCTGGAGCAGGAGGAAGAGGG + Intergenic
1178163695 21:29947900-29947922 GAGCAGGAGCTGGAGGAAGAGGG - Intergenic
1178418762 21:32426465-32426487 GAGCAGGAACACAGGGAAGGAGG - Intronic
1178471515 21:32897709-32897731 GAGCTAGAGCAGAAGGCAGAGGG + Intergenic
1178634860 21:34293277-34293299 AAGCATGTGCAGAGGCATGAAGG - Intergenic
1178702644 21:34846333-34846355 GGGCAGGAGAAGGGGGAAGAAGG - Intronic
1178707086 21:34885248-34885270 GATAAAGAGCAGAGGCAAGACGG - Intronic
1178748217 21:35274223-35274245 GAGCAAGAGCAGAGTGAACAAGG - Intronic
1179550580 21:42141040-42141062 GGACCTGAGCACAGGGAAGACGG - Intronic
1179977337 21:44875856-44875878 GAGAAGGAGCTGAGGGAGGAGGG - Intergenic
1180863897 22:19104887-19104909 CAGCAGCAGCAGAGGGGAGAAGG + Intronic
1181286805 22:21758422-21758444 GAGCAAGGAGAGAGGGAAGAAGG - Exonic
1181334993 22:22122897-22122919 GAGCAGCAGGAGAGGGGAGAAGG - Intergenic
1181468330 22:23122717-23122739 GTGGATGGGCAGTGGGAAGATGG + Intronic
1181469540 22:23129242-23129264 GACAATGAGCAGAGGGAGGAAGG - Intronic
1181484712 22:23223535-23223557 TACCAGGAGAAGAGGGAAGAAGG - Intronic
1181539466 22:23565780-23565802 GGACAGGAGCAGAGGGCAGAGGG - Intergenic
1182445367 22:30386773-30386795 GGCCATGAGCAGAGGGAGGTAGG + Intronic
1182454090 22:30438778-30438800 GAGCAGGAACTGAGGGAGGAGGG - Intergenic
1183225359 22:36546257-36546279 GAGCATAAACAGAGGCAAAAAGG - Intergenic
1183738855 22:39659077-39659099 GAGCATGAGCAGCATGCAGAAGG - Exonic
1184049146 22:41991413-41991435 GACCCTGAGCAGCAGGAAGATGG - Intronic
1184137244 22:42556471-42556493 GAGAATGAATAGGGGGAAGAAGG - Intronic
1184321920 22:43748407-43748429 GGACATGAGGAGAGGGAAGCCGG - Intronic
1184335491 22:43850590-43850612 GAGGGAGAGCAGAGGGAACAGGG - Intronic
1185164402 22:49251912-49251934 GAGTGTGAGCTGAGGGAAGGAGG + Intergenic
949188105 3:1218212-1218234 GAGCCTGAGGAAGGGGAAGAGGG + Intronic
949512081 3:4775191-4775213 GAGCAAAGGCAGAGGGAAGAGGG - Intronic
949688088 3:6600877-6600899 GAGCATGAGGAAAAGGTAGAAGG + Intergenic
950015020 3:9749383-9749405 AAGCATGAGCAGATGGAGTATGG + Intergenic
950020896 3:9787055-9787077 CAGCATGAACAGCCGGAAGATGG - Exonic
950090167 3:10289509-10289531 GAGCCTGGGCAGAGGAGAGAGGG - Intronic
950575945 3:13832126-13832148 GAGCCTGAGGAGGAGGAAGAGGG - Intronic
950579699 3:13854135-13854157 AAGCCTGAGAAGAGGGAGGAAGG + Intronic
950627744 3:14260529-14260551 GAGCAGGAGCAGAGAGAGAAGGG + Intergenic
952002003 3:28796823-28796845 GGCCAAGAGCAGAGAGAAGAGGG + Intergenic
952147136 3:30545643-30545665 GGGCAGGAGCAGAGGGTACATGG + Intergenic
952437751 3:33288981-33289003 GAGCCTGAGCAAGAGGAAGAAGG + Intronic
952707453 3:36393668-36393690 GAGGGAGAGCAGAGAGAAGAAGG - Intronic
952920114 3:38278182-38278204 GAGCATGAGCAGGAGGAGGCGGG - Exonic
953789960 3:45939719-45939741 GAGGCTGACCAGAGGGACGATGG - Intronic
954143784 3:48623974-48623996 CAGCATGAGCTGAGGTGAGAGGG - Intergenic
954225000 3:49175682-49175704 GAGCAGGAGCAGCGGGCAGTGGG - Exonic
954681554 3:52348818-52348840 GTGAATGAGCAGAGGGGAGATGG - Intronic
954859877 3:53678709-53678731 GAGAATGTGAAGAGGGAAGGTGG + Intronic
955035639 3:55264567-55264589 GAGGATGAGGAGAGAGAAGAAGG + Intergenic
955668119 3:61371741-61371763 TAGCCTGAGCAGATGGAAGTGGG - Intergenic
955688020 3:61563907-61563929 GAGGATGCGCAGAGAGAAAAGGG - Intronic
956290418 3:67654645-67654667 GAGGAGGAGCAGCGGGAGGAGGG + Intergenic
956715756 3:72078488-72078510 GAGCAAAAGCAAAGGGGAGAAGG - Intergenic
956753497 3:72363648-72363670 GAGGATGGGCAGAAGGAATAAGG + Intergenic
958896524 3:99835921-99835943 CAGCATGATCAAAGGTAAGAAGG + Intronic
959063301 3:101634782-101634804 GCGCATGAGCAGAGCCAAGGGGG - Intergenic
959385525 3:105701028-105701050 CTCCATCAGCAGAGGGAAGATGG + Intronic
959557091 3:107733040-107733062 CAGTATGAGCAGAGTGGAGACGG - Intronic
960630869 3:119729221-119729243 GATCCTTAGCAGCGGGAAGAAGG + Intronic
960730544 3:120722046-120722068 GAGAATGTGCTGTGGGAAGAAGG - Intronic
960922707 3:122763936-122763958 GGGCATGAGCAGAGGCCAGGAGG - Intronic
961184578 3:124903395-124903417 GAGCATGAGGAAAAGCAAGAGGG + Intergenic
961345405 3:126260528-126260550 GGGGAGGAGGAGAGGGAAGAGGG - Intergenic
961567043 3:127771282-127771304 GAGCAGGACCAGAGGGAGGATGG - Intronic
962203077 3:133415850-133415872 GAGGGTGAGTAGAGGGGAGAGGG - Intronic
962250041 3:133830490-133830512 CAGCATGAACAAAGGAAAGAAGG - Intronic
962491798 3:135901807-135901829 CAGCATGAGCAAAGATAAGAAGG + Intergenic
962902933 3:139776562-139776584 GGTCAAGAGCTGAGGGAAGAAGG + Intergenic
964820759 3:160766498-160766520 GAGAATGAGAAGTGGAAAGAGGG - Intronic
965158031 3:165089524-165089546 GAGCAGGAGCAGAGAGAAGAAGG + Intergenic
965199746 3:165642469-165642491 AAGAAGGAGCAGAGGCAAGAAGG - Intergenic
965233594 3:166086250-166086272 GACCAGTAGCAGAGGAAAGAAGG - Intergenic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
965843787 3:172938236-172938258 GAGAATGAGGAGAGGTAAAAGGG + Intronic
966310935 3:178593021-178593043 AAGTACGAGCAGAGGGAAGGGGG + Intronic
966908573 3:184544755-184544777 GAGGAGGAGGAGAGGGAGGAGGG - Intronic
966923484 3:184629641-184629663 GAGCACGCTCAGAGGGAAGGCGG + Intronic
967108705 3:186273954-186273976 GAGCAGGAGGAGAAGGCAGAGGG - Intronic
967464981 3:189794521-189794543 AAGCATCAGCAAAGGGAAGGGGG + Intronic
968464146 4:742117-742139 GAGCCTGGGCAGAGAGAGGAGGG - Intronic
968464167 4:742181-742203 GAGCCTGGGCAGAGAGAGGAGGG - Intronic
968464187 4:742241-742263 GAGCCTGGGCAGAGAGAGGAGGG - Intronic
969448770 4:7260830-7260852 GAGCAGCAGCAGGAGGAAGAGGG - Intronic
969476985 4:7427427-7427449 GAGCTTCAGCAGTGGGAGGATGG + Intronic
969560771 4:7946397-7946419 AAGCAGGAGCAGAAGGATGAGGG + Intergenic
969563108 4:7961905-7961927 CAGCATGAGGAGAGGGATCATGG - Intergenic
972356261 4:38281807-38281829 GAGGAGGAGGAGAGGAAAGAAGG - Intergenic
972688971 4:41378109-41378131 GAACATGAGCAGAGGCATGGAGG + Intronic
972944965 4:44242824-44242846 GAGCAGGAGCAAGAGGAAGAGGG - Intronic
974718450 4:65702865-65702887 GAGCATGAGCAAAGGAAACTGGG - Intergenic
975060287 4:69988681-69988703 TAGCAAAAGCAGGGGGAAGAAGG - Intergenic
975156489 4:71078651-71078673 GAGTATGAGCTGAGCGAAGAAGG - Intergenic
975655927 4:76641316-76641338 GAGGATGAGCAGGGAGAAGATGG - Intronic
975974700 4:80081538-80081560 GAGCATGAGAAGAGTGAGTAGGG + Intronic
976115983 4:81727194-81727216 TAGCAAAAGCAGAGGTAAGAGGG + Intronic
976392010 4:84515567-84515589 GATCTTGAGCAGAAGGAACAAGG + Intergenic
976874902 4:89841086-89841108 GAGCATGAGATGGGGGAATAGGG + Intergenic
977049640 4:92113133-92113155 GAGCAGAAGCAGAGGGTACACGG - Intergenic
977361370 4:96010603-96010625 GAGAATGATTAGATGGAAGAAGG + Intergenic
977398258 4:96498665-96498687 TAGAAAGAGCAGAGGGAAGGAGG + Intergenic
977422423 4:96818944-96818966 GAGCAGGAGGAGAGAGAACAGGG - Intergenic
978204424 4:106063577-106063599 GAGCTTGAGCAAAGGGGGGAAGG + Intronic
979741613 4:124158256-124158278 GAGCATGAGCATGGTGAAAAGGG + Intergenic
981341765 4:143629280-143629302 GAGCATGGAAAGAGGGAAGCTGG + Intronic
981530060 4:145743812-145743834 CAGCTTGAGCAAAGGCAAGAAGG - Intronic
982088138 4:151857190-151857212 TAGCATGAGGGGAGGGAGGAGGG - Intergenic
983092638 4:163523005-163523027 GAGCAAGAACAGTGGCAAGAAGG - Intergenic
983379837 4:166978700-166978722 GAGAAGGAGAAGAAGGAAGACGG + Intronic
983552572 4:169032490-169032512 AAGAAGGAACAGAGGGAAGAAGG - Intergenic
983855550 4:172639628-172639650 GAGCTGGAGGAGAGAGAAGAAGG - Intronic
983857190 4:172660838-172660860 GAGCTGGCTCAGAGGGAAGAGGG - Intronic
984118238 4:175709225-175709247 GAGGAGGAGAAGAGGGAGGAAGG - Intronic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
985388272 4:189467526-189467548 AAGCAGGTGCAGAGGGAAAATGG + Intergenic
985478797 5:94434-94456 GAGCAGGGGGAGAGTGAAGAGGG + Intergenic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985599768 5:821180-821202 GGGCAGGAGAAGAAGGAAGAGGG + Intronic
985718383 5:1475700-1475722 GATCATGAGCAGAGGGACCCTGG - Intronic
985767581 5:1787922-1787944 GAGCAGGAGGGGAGGGAGGAGGG - Intergenic
985780826 5:1869959-1869981 GAGCATGAGAAAATGGGAGAGGG + Intergenic
985783964 5:1884786-1884808 GAGCAGGAGGAGAGGGAAAGGGG - Intronic
986150905 5:5129743-5129765 CAGCAAGGGCAGAGGGCAGATGG - Intergenic
986268213 5:6208780-6208802 GAGGATGTGCAGAGGGGACATGG + Intergenic
987073704 5:14360819-14360841 GAGAATGAGCAGAGCCAAGAAGG - Intronic
987212570 5:15698105-15698127 GAGCATAAGCCAGGGGAAGAGGG + Intronic
988806062 5:34741807-34741829 TGGCATGGGAAGAGGGAAGAGGG + Intronic
988963362 5:36391424-36391446 GTGCGTGAGGAGAGGGAAAAAGG + Intergenic
989225364 5:39021591-39021613 GAGCATGAGCACAAGCAAGGTGG - Intronic
989490521 5:42047562-42047584 GAGCATTAGCAGAGAGATGGAGG + Intergenic
990182296 5:53174516-53174538 GAGGAGGAGGAGAAGGAAGAAGG + Intergenic
990334411 5:54757894-54757916 GAGCAGAAGCAGAGCAAAGATGG + Intergenic
990766198 5:59186056-59186078 GAGAAAGAGAGGAGGGAAGAAGG - Intronic
990849144 5:60181995-60182017 AGGCATTAGCAGAGGGAAGAAGG + Intronic
990999171 5:61765800-61765822 GAGCTTGAGTAGTGGGAGGATGG - Intergenic
991181193 5:63752949-63752971 GAGCAGGAGAAGAGAGGAGAGGG + Intergenic
992015537 5:72572009-72572031 GAGCAGAAGCAGATGGCAGATGG - Intergenic
992090649 5:73312971-73312993 GAGGAGGAGGAGAAGGAAGAAGG - Intergenic
992680204 5:79145446-79145468 TAGCATGGGGAGAGGGAGGAGGG - Intronic
992879956 5:81097959-81097981 GAGGATGGGCTGAGGGCAGAGGG + Intronic
993168820 5:84389434-84389456 CAGCATGAGCAGAGGGTTGGAGG - Intergenic
993532137 5:89037919-89037941 GAGCAAGGGCAGAGGGAAAAGGG - Intergenic
994187466 5:96831193-96831215 GAGCAGGAGAAGAGAGAGGAGGG + Intronic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
995059283 5:107796146-107796168 GGGCATGAGCAGAGTGAGCAGGG + Intergenic
995248367 5:109961191-109961213 GAGCATAAGAAGATGGAAGAGGG + Intergenic
995735851 5:115298373-115298395 GAGAAGGAGAAGAGAGAAGAAGG + Intergenic
995975322 5:118028766-118028788 GAGAAGGAGCGGAGGGGAGAAGG - Intergenic
996139664 5:119890712-119890734 AAGAATGAACAGAGGGAATATGG - Intergenic
996217469 5:120887122-120887144 CAGCACCAGCAGAGGGTAGAAGG + Intergenic
997013273 5:129904170-129904192 GAGCAAGAGCTGGGGGAGGAGGG + Intergenic
997353961 5:133250453-133250475 TGGCATGAGCTGAGGGAAGCAGG + Intronic
997413218 5:133705758-133705780 GAGGATGAGTAGAGGGGAAAGGG - Intergenic
997585397 5:135040351-135040373 GCCCCTGAGGAGAGGGAAGAAGG - Intronic
997892913 5:137690873-137690895 GTGCTTGAGCAGGGGTAAGAAGG + Intronic
998179188 5:139924625-139924647 GAGCAAGAGCAGATGGAAAGAGG - Intronic
998367154 5:141638941-141638963 CAGCATTGGCTGAGGGAAGAAGG - Exonic
998406844 5:141878815-141878837 GAGCAGGTGCCCAGGGAAGAAGG - Intronic
998562427 5:143183948-143183970 TACCATGAGGAGAGGAAAGAAGG - Intronic
999147500 5:149405984-149406006 CAGCATGAGCTCTGGGAAGAAGG + Intergenic
999383040 5:151135063-151135085 GAGGATGCACAAAGGGAAGAGGG + Intronic
999473254 5:151874925-151874947 GAGCATGAGGAGGGGAAGGAAGG + Intronic
999721519 5:154402241-154402263 GGGCAGGAGCAGAGGGAGAAAGG - Intronic
1000010112 5:157223132-157223154 GAGCAGAGGCAGAAGGAAGAGGG + Intronic
1000435274 5:161200251-161200273 AAGCATGATTTGAGGGAAGAAGG - Intergenic
1001095316 5:168771313-168771335 GAGCATGAGACCAGGGAAGGAGG + Intronic
1001252229 5:170155180-170155202 AAGCATGAGGAGAAGGATGAGGG + Intergenic
1001313641 5:170628022-170628044 AAGCAGGAGCAGAAGGAAGAGGG - Intronic
1001441795 5:171749383-171749405 GAGAATGAGCAGAGGCTTGATGG - Intergenic
1001509459 5:172309114-172309136 GAGAATGAGCAGAAGGAATATGG + Intergenic
1001801502 5:174548234-174548256 GAGGGTGAGGAGAAGGAAGAAGG - Intergenic
1002206198 5:177564180-177564202 GAGCAAGAGGAGAGGGAGGAAGG - Intergenic
1002352440 5:178592412-178592434 GAGCAGAGGCAGAAGGAAGAAGG + Intergenic
1002434368 5:179221861-179221883 GGGCTGGAGCAGAGGGAAGGAGG - Intronic
1002787727 6:417238-417260 GAGCAGAGGCAGAGGGCAGAGGG - Intergenic
1002899548 6:1399463-1399485 GAGGAGGAGGAGAGGGAAGCAGG + Intergenic
1002931658 6:1639151-1639173 GAGCAGGAGCGGAGGAGAGAGGG + Intronic
1002985069 6:2181773-2181795 AGGCCTGAGGAGAGGGAAGAGGG - Intronic
1003231391 6:4256832-4256854 GAGTTTGAACAGAGGAAAGACGG + Intergenic
1003429003 6:6022000-6022022 AGGCATGCACAGAGGGAAGATGG + Intergenic
1003637399 6:7845319-7845341 GAGCATCAGCACAGGTATGAAGG + Exonic
1003849110 6:10203712-10203734 GAACATTAGCAGAGGAAAAAAGG - Intronic
1003906615 6:10706324-10706346 GAGAATGAGCAAGGAGAAGACGG + Intronic
1004022530 6:11788251-11788273 AAGGATGAGGAGAGGGCAGAGGG - Intronic
1004423254 6:15489871-15489893 AAGGAGGAGGAGAGGGAAGAGGG - Intronic
1004485044 6:16058585-16058607 GATCCTGAGCAGAGGGCAGGAGG - Intergenic
1004793983 6:19060686-19060708 AACCATGAGCAGAAGGAAGGAGG - Intergenic
1005091506 6:22061692-22061714 GGGCAGGAGCAGATGGAGGAAGG - Intergenic
1005198483 6:23316219-23316241 CAGCATGAGCAAAGGAATGAGGG + Intergenic
1005348129 6:24910234-24910256 GAGGATGAGAATTGGGAAGAGGG - Intronic
1005693910 6:28333900-28333922 GAGAATGAGCTGAGGGAATGAGG + Intronic
1005959943 6:30687317-30687339 GACAATGAGGAGAGGGAAGGGGG + Exonic
1006173795 6:32109859-32109881 GAGCAGGGGCAGAGGGCAGGAGG + Intronic
1006176746 6:32127152-32127174 GAGGAAGAGCAGGGGGAAGATGG + Exonic
1006255667 6:32830207-32830229 GAGCATGTACAGAGAGAGGATGG - Intronic
1006266649 6:32931345-32931367 GCCTAAGAGCAGAGGGAAGAGGG + Intergenic
1006442175 6:34059574-34059596 CAGCATGTGCAGAGGGGTGAGGG - Intronic
1006613942 6:35312195-35312217 GAGCCTGGGCAGAGGGAAACAGG - Intronic
1007099968 6:39239433-39239455 GAGCAGTAGCAGTGGGAAGCAGG + Intergenic
1007217024 6:40248332-40248354 GAGAATGGGCAAAGGGAGGAAGG - Intergenic
1007431551 6:41780040-41780062 GAGCATGCGCAGACGCCAGAGGG + Intronic
1007637445 6:43307899-43307921 GGGCACAAGCAGAGGGAAGTGGG + Intronic
1007746698 6:44047617-44047639 GGGCATGAGCAGAGGGGTGTGGG - Intergenic
1007955294 6:45912489-45912511 GAGCAAGAGAAAAGGAAAGAAGG + Intronic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1008739244 6:54585204-54585226 GAGCATCATTAGTGGGAAGATGG - Intergenic
1009527722 6:64767415-64767437 GAGTATGGGGAAAGGGAAGATGG - Intronic
1009535431 6:64877000-64877022 TAACATCAGAAGAGGGAAGATGG + Intronic
1010255644 6:73754275-73754297 GAGCCTGAAGAGTGGGAAGAGGG + Intronic
1010793356 6:80090649-80090671 CAGCATGAGCAGCAGGAAAATGG + Intergenic
1010863915 6:80948800-80948822 GAGCATGAGCACATTGTAGAGGG - Intergenic
1011283866 6:85704058-85704080 GAGCAGGAAGAGAGAGAAGAGGG - Intergenic
1011616145 6:89200044-89200066 GAGCATCAGAGCAGGGAAGAAGG - Intronic
1011716029 6:90105998-90106020 GAGCTTCAGAAGAGGGAAGAAGG + Intronic
1011842368 6:91517409-91517431 GGCCATGAGCAGAGTGAGGAGGG + Intergenic
1011888420 6:92126674-92126696 GAGGAGGAGCAGGAGGAAGAGGG + Intergenic
1013042885 6:106453906-106453928 GAGCCGGAGCAGGGAGAAGAAGG + Intergenic
1013367139 6:109444992-109445014 GAACCTGAGAAGAAGGAAGATGG + Exonic
1013967437 6:115971898-115971920 GACTAAGAGCAGAGAGAAGAGGG + Intronic
1014001484 6:116370802-116370824 GAGGATGAGGAGAGGGAAACGGG - Intronic
1015547866 6:134379991-134380013 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1016070514 6:139733063-139733085 GAGGATGGGGAGAGGGAAGCAGG + Intergenic
1016114526 6:140263401-140263423 GAACATGAGCAGAAGAAGGAGGG - Intergenic
1016325450 6:142896275-142896297 GAGCAGGAGGAGGAGGAAGATGG - Intronic
1016348983 6:143146972-143146994 GAAGATGAGGAGAGGGCAGATGG + Intronic
1017277021 6:152581546-152581568 GGCCATGAGCAGTGGGAAGTTGG - Intronic
1017418892 6:154251842-154251864 GTGCAAGAGAAGACGGAAGAAGG + Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018111920 6:160544616-160544638 GACCTTGAGCTGGGGGAAGAAGG - Intronic
1018546544 6:164942833-164942855 GAGATTGAGCAAAGGCAAGAGGG + Intergenic
1019223704 6:170494223-170494245 GAGAATGAGGAGAGGGCAGATGG - Intergenic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1019508412 7:1404943-1404965 GAGAGGGAGGAGAGGGAAGAGGG + Intergenic
1019531766 7:1506748-1506770 GAGCAGGAGGAGAGAGAAGGGGG - Intergenic
1019830276 7:3321683-3321705 GAGGAGGAGGAGAAGGAAGAAGG - Intronic
1019838310 7:3413268-3413290 TATCATGAGCAGAGGGGAGCAGG + Intronic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1020130735 7:5557152-5557174 GAGCATGAGCTGGGGGTGGAGGG + Intronic
1020375152 7:7477205-7477227 GAGCAGGAGGAGAGAGAAAAGGG + Intronic
1021184207 7:17543905-17543927 GAGAAAGTGCAGAGGGATGAAGG + Intergenic
1021955935 7:25824358-25824380 GAGCCAGGGCAGAGGGGAGATGG - Intergenic
1023000694 7:35804373-35804395 GAGCATGGGCTTGGGGAAGAGGG + Intronic
1023119988 7:36899448-36899470 CAGCATGAGCAAAGGCAAGGAGG + Intronic
1023330019 7:39105088-39105110 CATCAAGAGCAGAGGGCAGATGG + Intronic
1023693448 7:42818728-42818750 GAGAAGGAGAAGAAGGAAGAAGG + Intergenic
1023758270 7:43440202-43440224 GAGCATGTGCTGAGGGCAGAGGG - Intronic
1023837694 7:44077978-44078000 GAGCAGAAACAGAGGGAAGGTGG + Intronic
1023839628 7:44089058-44089080 GAGCAGGCCCAGAGGGAAGGAGG - Intergenic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1024586171 7:50843925-50843947 GAGCATGGTCAGAAGCAAGAAGG + Intergenic
1025887775 7:65614523-65614545 GAGGAGGAGCAGATGGAAGGAGG - Intergenic
1026182940 7:68058132-68058154 GAGCAGGCTCAGAGGGAAGCTGG + Intergenic
1026427957 7:70315506-70315528 GAGCATGAACAGTGGGAAGAGGG - Intronic
1026545174 7:71316141-71316163 GAGCAGGAGCAAAGGGAGGAAGG + Intronic
1027194470 7:76020205-76020227 CAGGATGAGCTTAGGGAAGAAGG + Intronic
1028394715 7:90355748-90355770 GATCCTAAGCAGAGGCAAGAAGG - Intronic
1028637041 7:93000853-93000875 GAGCAGGTGCAGAGGAAAGAGGG - Intergenic
1029008354 7:97232956-97232978 AAGAATGAGAAAAGGGAAGAGGG + Intergenic
1029493429 7:100884523-100884545 AAGGATGAGAAGAAGGAAGACGG + Exonic
1031598049 7:123670401-123670423 AATCATGAGAAGAGGAAAGAAGG - Intergenic
1031619815 7:123922714-123922736 GAGCAACAGCAGAGGCAGGAAGG - Intergenic
1031854602 7:126907187-126907209 GAGGAGGAGCAGATGGAAGGAGG + Intronic
1031868051 7:127061610-127061632 AAGCATCAGCAGGGGGAGGAAGG - Intronic
1031931486 7:127690388-127690410 CTGCATGAGCTGAGGGCAGAAGG - Intronic
1032738763 7:134717619-134717641 GAGCCTGAGCACAGGGAGGCGGG - Intergenic
1032961682 7:137042489-137042511 GAGAGAGAGAAGAGGGAAGAGGG - Intergenic
1033781864 7:144680361-144680383 CAGCCTGAGCAGAGGAGAGAAGG + Intronic
1033792620 7:144809533-144809555 GTGTATGAGCAGAGAGATGATGG - Intronic
1033890435 7:146006407-146006429 GAGAAGGAGCAGGGGGAGGATGG - Intergenic
1033897134 7:146086890-146086912 GCACATAAGCAGAGAGAAGAAGG - Intergenic
1033955231 7:146839686-146839708 GAAGATGGGCAGAGGTAAGATGG - Intronic
1034615357 7:152411523-152411545 GAGAAAGAGGAGGGGGAAGAAGG + Intronic
1035419667 7:158717150-158717172 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419693 7:158717283-158717305 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419753 7:158717611-158717633 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419768 7:158717685-158717707 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035768424 8:2127121-2127143 GAATTTGAGCAGAGGGAAGGGGG + Intronic
1037152254 8:15651571-15651593 GTGCATGTGCAGAGAGAAAAGGG + Intronic
1037547586 8:19939594-19939616 GAGGATGAGAAGAAGGAAGTTGG + Intronic
1037861460 8:22408454-22408476 GAGAATGAGCAGACGGAGGAGGG + Exonic
1037944010 8:22975199-22975221 GAGCAGCATCAGAGGGGAGAGGG - Intronic
1038240093 8:25800453-25800475 GAGACTGAGCAGAAGGAATATGG - Intergenic
1038303259 8:26375627-26375649 AAGGATGAGAAGAGGGAAGAAGG - Intergenic
1038307971 8:26421711-26421733 GATGATAAGCAGAGGGAATATGG + Intronic
1038523797 8:28256372-28256394 GAGAAAGAGGAGAGGGGAGAGGG + Intergenic
1039910496 8:41823024-41823046 GAGCATGAGCGGAGGCAGAAGGG + Intronic
1040705597 8:50122625-50122647 GCTCAGGAGCAGTGGGAAGATGG + Intronic
1040889472 8:52301996-52302018 GAGCCAGAGCAGAGTGAAGATGG + Intronic
1041330480 8:56719109-56719131 GGGCAGGAGGAGAGGGAAGAGGG - Intergenic
1041347107 8:56910754-56910776 GAGCAAGAGCACAGGGAGGGAGG + Intergenic
1041605487 8:59778309-59778331 GAGAAGGAGGAGAGGGAAAATGG - Intergenic
1041812669 8:61928696-61928718 GTCCAACAGCAGAGGGAAGAAGG + Intergenic
1041858865 8:62488323-62488345 CAGAATTAGCAGAGGAAAGAAGG - Intronic
1042960114 8:74294239-74294261 GAGCAGGAGCTGAGGGCAGGTGG - Intronic
1043469157 8:80544835-80544857 GAAAGTGAGCAGAGGGAAGCTGG + Intergenic
1043548773 8:81344856-81344878 AAGCAAGAGGAAAGGGAAGAGGG - Intergenic
1043781027 8:84335284-84335306 AAACATCAGCAGAGAGAAGATGG - Intronic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1044666634 8:94639959-94639981 AAGCATGAGCAGAGGGAATGGGG + Intergenic
1044722043 8:95160184-95160206 GAGCCTCAGCAGAGGGAATGGGG - Intergenic
1045199581 8:99967069-99967091 GAGCATGAGCAGAAGCAGGGTGG + Intronic
1045236103 8:100353781-100353803 GAACAGGAGCAAAAGGAAGAGGG + Intronic
1046645766 8:116783795-116783817 CAGCATGAGCAGGCAGAAGAGGG - Intronic
1047042118 8:121007698-121007720 GGGCATGAGAAGTGGGAAGTGGG + Intergenic
1047896550 8:129372966-129372988 GAGCATGGTCAGAGGAAAAAGGG + Intergenic
1047998521 8:130358405-130358427 CGGCATGAGCAGAGGGAGGCGGG - Intronic
1048012112 8:130466219-130466241 GAGGAAGAGAAGGGGGAAGAAGG - Intergenic
1048102422 8:131368224-131368246 GAGTATGAGGAAGGGGAAGATGG + Intergenic
1048384650 8:133900901-133900923 GAGCCTAAGCAGAGTGAGGAGGG - Intergenic
1048743238 8:137585533-137585555 GAGGATGGGGAGAGGGGAGAAGG - Intergenic
1049212938 8:141395043-141395065 GAGCCTGAGCAGAGGGTGGAGGG + Intronic
1049351653 8:142167847-142167869 GGGCAGGTGCAGAGGGAGGAAGG - Intergenic
1049450279 8:142657597-142657619 TAGCAAGAGCAGGAGGAAGAAGG + Exonic
1049611323 8:143557038-143557060 GGGCACGTCCAGAGGGAAGAAGG - Intronic
1049796538 8:144499713-144499735 GAGCATGGCCCCAGGGAAGAAGG - Intronic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1050119074 9:2289377-2289399 GGGCATCAGCAGAGGGAAGCAGG + Intergenic
1050577434 9:7011848-7011870 CGGCATGAGCAGAGTGCAGATGG - Exonic
1050655122 9:7819526-7819548 GAGCATGGGCAAAGGGCAGGAGG + Intronic
1051342581 9:16125562-16125584 GAGCAAGAGTAGAAAGAAGAGGG + Intergenic
1052494534 9:29211513-29211535 GAGCATCAGAAGAGGAAGGAGGG - Intergenic
1052583979 9:30400552-30400574 CAGAAGGAGCAGAGAGAAGAGGG - Intergenic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1052968766 9:34363622-34363644 GAGCAGCAGCAGGGGGAAGGGGG - Intergenic
1053151110 9:35743747-35743769 AAGCTTCAGAAGAGGGAAGAAGG + Intronic
1053283688 9:36837444-36837466 GAGCTCGAACACAGGGAAGAAGG + Exonic
1053448988 9:38177630-38177652 GGGCATCTGCACAGGGAAGAAGG - Intergenic
1053462584 9:38282021-38282043 GAGGCTGAGCAGAGGGCAGAGGG + Intergenic
1053518302 9:38751405-38751427 GAGCAAGAGCAGAGATTAGAGGG - Intergenic
1054840301 9:69731210-69731232 GAGCATGGGAAGAGGGATGTAGG + Intronic
1055673161 9:78627410-78627432 CTGCAAGAGCAGAGGGGAGAGGG - Intergenic
1055754299 9:79541201-79541223 GGGCATGAACTGAGGGGAGATGG + Intergenic
1056587691 9:87939032-87939054 GAGGATTAGGAGAAGGAAGAGGG - Intergenic
1056815052 9:89795114-89795136 GAGCAGGAGCAGAGCCAGGACGG - Intergenic
1057231581 9:93324662-93324684 GAGGCTGGGGAGAGGGAAGAGGG + Intronic
1057236508 9:93365955-93365977 GAGGCTGGGGAGAGGGAAGAGGG - Intergenic
1057497418 9:95571969-95571991 GAGGAGGAGGAGAGGGAGGAGGG + Intergenic
1057931312 9:99195955-99195977 GAGGAAGAGCAGAGGGAAGAGGG - Intergenic
1058808585 9:108617285-108617307 GAACATGTGCAGAGGGTATAAGG - Intergenic
1058868200 9:109180597-109180619 GAGGATGAGCAGAGGTGGGAAGG - Intronic
1059036145 9:110755731-110755753 GAACAGGAGGAAAGGGAAGAAGG - Intronic
1059055051 9:110970663-110970685 GAGAAGGAGGAGAGGGAAAAAGG - Intronic
1059155192 9:111983313-111983335 GAGCCTGATCACAGGGCAGAGGG - Intergenic
1059217120 9:112574615-112574637 GAGCTTGAATGGAGGGAAGATGG - Exonic
1059303397 9:113333957-113333979 GAGAAGGAGGAGAAGGAAGAAGG - Intronic
1059323347 9:113486327-113486349 AAGCATGAGCAAAGGCAAGGAGG + Intronic
1060437199 9:123604136-123604158 GAGCATGAGCTGAGGTAAGCAGG - Intronic
1061264434 9:129497131-129497153 GAGCAGGAGAGGAGGGGAGAAGG + Intergenic
1061363886 9:130160457-130160479 GAGAATGAGCTGAGTGAAAAGGG + Intergenic
1061650712 9:132047250-132047272 GAGCATGAGATGAGGGGAGGAGG + Intronic
1061731146 9:132615014-132615036 GAGAATGTGCAGAAGGAACAGGG + Intronic
1061796388 9:133087957-133087979 GGGCAGGGGCAGAGGGCAGAAGG + Intergenic
1061865664 9:133490768-133490790 GAGGAGGAGGAGAGGGAGGAGGG + Intergenic
1061886720 9:133594804-133594826 GAGGATGAGTAGCGAGAAGATGG + Intergenic
1062190716 9:135246619-135246641 GAGGATGAGCAGAAGGAAGGAGG - Intergenic
1062729287 9:138100177-138100199 GAGGTGGGGCAGAGGGAAGAGGG + Intronic
1185449555 X:275213-275235 GAGAAGGAGCAGGGGGAGGAAGG + Intergenic
1185499314 X:585020-585042 GAACAAGAGAAGGGGGAAGAGGG + Intergenic
1185616558 X:1425433-1425455 GAGCCTGGGCAGAGCGAGGAAGG - Intronic
1185745945 X:2573529-2573551 GAGCATTTGCAGAGGGAGGGAGG + Intergenic
1186011494 X:5139050-5139072 GAAGATGGGCAGAGGGGAGAAGG + Intergenic
1186337941 X:8611393-8611415 GAACAAGAGAAGAGAGAAGATGG + Intronic
1186598052 X:11006147-11006169 GTGGATGAGAGGAGGGAAGAAGG - Intergenic
1186659193 X:11651280-11651302 GAGGGTGAGCAGTGGGAGGAGGG - Intronic
1186664555 X:11704273-11704295 GATCATGGCCAGGGGGAAGAAGG + Intergenic
1186688623 X:11951591-11951613 GAGGGTGAGCAGTGGGAGGAGGG + Intergenic
1186902455 X:14071763-14071785 TACCAAGAGCAGCGGGAAGAAGG - Intergenic
1187081538 X:15994480-15994502 GAACAAGATAAGAGGGAAGAAGG - Intergenic
1187225786 X:17374923-17374945 CAGTAAGCGCAGAGGGAAGAGGG - Intergenic
1189088400 X:38051194-38051216 GGAGATGACCAGAGGGAAGAGGG + Intronic
1189158980 X:38791134-38791156 GAATGTGAGCAGAGAGAAGATGG - Intergenic
1190008025 X:46758781-46758803 GAGCGTGAGCAGCAGGATGAAGG + Exonic
1190217468 X:48489446-48489468 GGGCAGGAGCAGAGTGAACAAGG + Intergenic
1190753482 X:53381445-53381467 CAGCATGTGCAGAGGCAAGGAGG - Intronic
1191115669 X:56849739-56849761 GAGCTAGAGCAGTGTGAAGAGGG + Intergenic
1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG + Intergenic
1192399145 X:70816882-70816904 GAGAATGAGCATGGAGAAGAGGG + Intronic
1194501029 X:94680943-94680965 GAGCAGGAGGAGAGAAAAGAGGG - Intergenic
1194591124 X:95800936-95800958 GAACATCAGGAGAGCGAAGAAGG - Intergenic
1194938328 X:99978916-99978938 CAGCATGAACAGGGTGAAGAGGG - Intergenic
1195615069 X:106905674-106905696 GAGAATCAGCAGAAGGAAGGAGG + Intronic
1196124282 X:112082691-112082713 GAACAGGAGCAGAGGGAAGCCGG - Exonic
1196553156 X:117054655-117054677 GAGCATGAGCAAAGTTATGAAGG - Intergenic
1196764621 X:119231713-119231735 GAGGATGAGGAGTAGGAAGAAGG + Intergenic
1196980864 X:121212146-121212168 GGGCAAGAGCAAAGGGAAGAAGG - Intergenic
1197710318 X:129661656-129661678 CACAATGAGGAGAGGGAAGATGG - Intergenic
1198314605 X:135453035-135453057 GAGCAAAAGCATATGGAAGAGGG - Intergenic
1199996179 X:153028193-153028215 GAGCCTGAGGAGAGGGGAGGAGG + Intergenic
1200051527 X:153434306-153434328 GAGCAGGGGCAGAGGACAGACGG + Intergenic
1201057025 Y:10004222-10004244 TAAAATGAGCAGAGGAAAGATGG - Intergenic
1201143446 Y:11047410-11047432 GAGCATAAGGAGAGGGAGGGAGG + Intergenic
1202088496 Y:21163704-21163726 GAGCAGGTGCAGATGGAGGAAGG + Intergenic