ID: 925997864

View in Genome Browser
Species Human (GRCh38)
Location 2:9306679-9306701
Sequence GACAATTCCCTCAGCGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 63}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925997864_925997866 30 Left 925997864 2:9306679-9306701 CCTGGCTCGCTGAGGGAATTGTC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 925997866 2:9306732-9306754 GTTTGCATTCCTCCTTCTTTGGG 0: 1
1: 0
2: 7
3: 33
4: 298
925997864_925997865 29 Left 925997864 2:9306679-9306701 CCTGGCTCGCTGAGGGAATTGTC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 925997865 2:9306731-9306753 TGTTTGCATTCCTCCTTCTTTGG 0: 1
1: 1
2: 10
3: 84
4: 596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925997864 Original CRISPR GACAATTCCCTCAGCGAGCC AGG (reversed) Intronic
903262559 1:22139269-22139291 GCCATTTCCATCAGCGTGCCTGG + Intronic
908842929 1:68296633-68296655 GAAACTGCCCTCAGGGAGCCAGG - Intergenic
912937064 1:114012745-114012767 GAAAAGTCCCTCACCCAGCCTGG - Intergenic
924953843 1:248908856-248908878 AACAATTCCCTCAGCAGGCAGGG - Intronic
1064353988 10:14601640-14601662 GACAACTCCCCCAGATAGCCGGG + Intronic
1068449947 10:57173417-57173439 AACAATTCCCTCAGAAATCCAGG + Intergenic
1069331723 10:67301052-67301074 GCCAAATCCCTTAGTGAGCCAGG + Intronic
1073587947 10:104728805-104728827 GACTAGTCTCTCAGTGAGCCTGG - Intronic
1077460282 11:2705648-2705670 AACAATCCCCTCAGCCTGCCAGG + Intronic
1081675815 11:44968339-44968361 GATGATTCCCTGAGTGAGCCTGG - Intergenic
1083994273 11:66264512-66264534 GACAAATCCCTCAGCAGGGCAGG + Intronic
1085424561 11:76392422-76392444 GCCAATTCCCTCATCGAGTTTGG - Intronic
1088151478 11:106750351-106750373 GACATTTGCCTCAGTGAGCTAGG - Intronic
1103357272 12:120331037-120331059 GACAATTCCAATAGAGAGCCAGG - Intergenic
1104820705 12:131675753-131675775 GATGAGTCCCTCAGCGAGGCAGG + Intergenic
1106646375 13:31638630-31638652 TGCAATTACCTCAGGGAGCCAGG - Intergenic
1108221093 13:48233590-48233612 GACAAGTCCCCGAGAGAGCCCGG + Intronic
1120007415 14:79375131-79375153 GACTAGTCCCTCAGCGAGTCAGG + Intronic
1122138665 14:99649213-99649235 AAAAGTTCCCTCAGGGAGCCAGG - Intronic
1130979612 15:88803579-88803601 GTCCATTCCCTCAGCCAGCCAGG + Exonic
1133362694 16:5186715-5186737 GACGGCTCCCTCAGCTAGCCGGG - Intergenic
1136117231 16:28102223-28102245 GTCAAATCCCTCAGCAATCCTGG + Intronic
1141911439 16:87061786-87061808 GACAATGACTTCATCGAGCCTGG - Intergenic
1143608325 17:8003369-8003391 GACACGGCCCCCAGCGAGCCCGG - Exonic
1152267929 17:79306951-79306973 GAAAACTCCCTCAGAGGGCCTGG - Intronic
1155506772 18:26541103-26541125 TCCAATTCCCTCAGCTATCCAGG + Intronic
1156392200 18:36660791-36660813 GTTAAATCCCTCAGAGAGCCTGG + Intronic
1163578791 19:18125754-18125776 AACAACTCCCACAGCCAGCCAGG + Intronic
1163828765 19:19538031-19538053 GACACTTCCCTCAGGCAGCTTGG + Intergenic
1163988239 19:20972395-20972417 TACAATTCCCCCTGTGAGCCTGG - Intergenic
1164563503 19:29309944-29309966 CACAGTGCCCTCCGCGAGCCTGG - Intergenic
925997864 2:9306679-9306701 GACAATTCCCTCAGCGAGCCAGG - Intronic
930848446 2:55931711-55931733 GACAATTCACTTGGCCAGCCTGG + Intergenic
932852435 2:75200134-75200156 GACACTTTCCTCAGCCACCCTGG + Intergenic
935050077 2:99517880-99517902 CACACTTCCCTCAGCCAGCCTGG + Intergenic
935809652 2:106785168-106785190 GAAAATGCCTTCAGTGAGCCAGG - Intergenic
944951410 2:204754014-204754036 GACACTTGCATCAGCCAGCCTGG - Intronic
945676250 2:212858671-212858693 GACAATTCCCACACCCAGCATGG - Intergenic
948516905 2:238509862-238509884 GGCACTTCCCTCAGCCATCCTGG + Intergenic
1170581346 20:17701780-17701802 GAAAACTCCCTCAACCAGCCTGG - Intronic
1174290208 20:49503025-49503047 GACAATTCTTCCAGCGACCCAGG + Intergenic
1177899343 21:26894572-26894594 GACAATTCCCTGAGATATCCTGG - Intergenic
1178518737 21:33269409-33269431 GACAAGTCCTTCAGTGAGGCAGG + Intronic
1182463220 22:30496920-30496942 GACAAATTCCTCAGTGAGCCAGG - Intronic
1182966070 22:34522118-34522140 GCCAACTCCCTTAGCAAGCCAGG - Intergenic
1184445761 22:44545900-44545922 GAAAATGCCCCCAGGGAGCCTGG + Intergenic
1184452386 22:44590853-44590875 GACAATTACCTCCACCAGCCTGG - Intergenic
954407167 3:50351645-50351667 CAGAATTCCCTCAACCAGCCAGG - Intronic
955490770 3:59479994-59480016 GACATTCCCCTCAGCGAGAGAGG + Intergenic
959085772 3:101849540-101849562 GACAGCTCCCTGAGCCAGCCCGG + Exonic
967921144 3:194615408-194615430 CACTATTCCCTCAGCGAGACAGG + Intronic
968549078 4:1213233-1213255 GACAGGTCCCTCAGCAAGCTGGG - Intronic
973781391 4:54291171-54291193 GACTATGCCCTCTGCCAGCCTGG + Intronic
976736330 4:88313538-88313560 GACAGCTCCCTCAGCTTGCCGGG - Intergenic
981716123 4:147754048-147754070 GACACTGCCCTCAGTAAGCCAGG - Intronic
983614283 4:169684569-169684591 GACATTTCCCGCAGCAAACCTGG + Intronic
997208585 5:132064766-132064788 GGCAATGCCCTCAGTGAGCCAGG - Intergenic
1001144232 5:169169990-169170012 GACTATTCCCTCTGCGAGGAAGG - Intronic
1017085323 6:150707999-150708021 GAGAATTCCTACAGGGAGCCTGG - Intronic
1022756400 7:33296579-33296601 GGCAATTCTCTCAGCTAGCCAGG + Intronic
1024125734 7:46292733-46292755 GGGAACTCCCTCAGTGAGCCTGG - Intergenic
1035587417 8:786581-786603 CACAGTTCCCTCAGAGACCCAGG + Intergenic
1041380955 8:57254110-57254132 GACAATTCCATCAGTGACACAGG + Intergenic
1042787250 8:72562211-72562233 GACACTTCCTTCATGGAGCCAGG - Intronic
1049622379 8:143604543-143604565 GAGCATGCCCTCAGCGAGGCTGG - Exonic
1053001630 9:34579942-34579964 GAGGATTGCCTCAGCGAGCAGGG - Intronic
1061578673 9:131523527-131523549 GGCCCTGCCCTCAGCGAGCCCGG + Exonic
1062123681 9:134848184-134848206 GACAGCTGCCTCAGCGACCCAGG + Intergenic
1199954989 X:152735334-152735356 TGCTATTCCCTCAGAGAGCCTGG + Intronic
1200971628 Y:9158756-9158778 AACACTTCCCTCAGGAAGCCAGG + Intergenic
1202139389 Y:21705538-21705560 AACACTTCCCTCAGGAAGCCAGG - Intergenic