ID: 925997926

View in Genome Browser
Species Human (GRCh38)
Location 2:9307051-9307073
Sequence CTGCTGGTGCAGCTGGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 777
Summary {0: 1, 1: 2, 2: 10, 3: 97, 4: 667}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925997926_925997936 30 Left 925997926 2:9307051-9307073 CCCTGGGCCAGCTGCACCAGCAG 0: 1
1: 2
2: 10
3: 97
4: 667
Right 925997936 2:9307104-9307126 GCCTCCACACCTCACCTGCAGGG 0: 1
1: 1
2: 3
3: 43
4: 310
925997926_925997935 29 Left 925997926 2:9307051-9307073 CCCTGGGCCAGCTGCACCAGCAG 0: 1
1: 2
2: 10
3: 97
4: 667
Right 925997935 2:9307103-9307125 AGCCTCCACACCTCACCTGCAGG 0: 1
1: 0
2: 3
3: 33
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925997926 Original CRISPR CTGCTGGTGCAGCTGGCCCA GGG (reversed) Intronic
900097204 1:944740-944762 GAGCTGCAGCAGCTGGCCCAGGG - Exonic
900098111 1:948592-948614 CTGCTGGAACATCTGCCCCAAGG + Exonic
900179087 1:1303527-1303549 CTGCTGGTCCTGCTGGCCCTGGG - Intronic
900701183 1:4049544-4049566 CTGCAGCTGCGGCTGGCTCATGG + Intergenic
900703520 1:4062188-4062210 GTGCTTGTGCCGCTGGCCCCAGG - Intergenic
900906529 1:5563594-5563616 CTGCTGGTGCAGTGGGCCGCTGG - Intergenic
900919742 1:5662693-5662715 CTGCTGCTGCTGGAGGCCCAGGG - Intergenic
901056919 1:6452671-6452693 CTGCTGATGCTGCTGGTCCAAGG + Intronic
901104289 1:6743361-6743383 ATGCCGACGCAGCTGGCCCATGG - Intergenic
901771289 1:11531633-11531655 CTCCCGGGGCAGCTGTCCCACGG + Exonic
901943027 1:12678375-12678397 CTCCTGGGGCAGCTGACACAGGG + Intergenic
902087975 1:13877797-13877819 CTGCTGGTGCTACTGGTACAGGG - Intergenic
902148161 1:14420764-14420786 CGGCTGGTGCCGCCGGCCCCGGG - Intergenic
902271889 1:15310581-15310603 ATGCTGATGCTGCTGGTCCAGGG - Intronic
902397697 1:16141528-16141550 GTGCTGGTTCAGGTGGTCCAGGG + Intronic
903232638 1:21931337-21931359 GTGCTGGGGCAGCTGGCCCCGGG + Intronic
903606684 1:24580073-24580095 CTGCCGGTGCTGCTGATCCATGG + Intronic
903958342 1:27040414-27040436 CAGCTGCTGCAGCTGCCTCAAGG + Intergenic
904422612 1:30403931-30403953 CTCCTGCTGGAGCTGGCCCCAGG - Intergenic
904928548 1:34067558-34067580 ATGCTGGTGCTACTGGCTCATGG - Intronic
904975229 1:34451092-34451114 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
906002968 1:42443122-42443144 ATGCTGGTTCAGCTGGGCCTTGG - Intronic
906057936 1:42930656-42930678 CAGCTGGTGCAGGGTGCCCAGGG + Exonic
906273392 1:44498824-44498846 CTGATGGTGCTGCTGTTCCAAGG + Intronic
906527896 1:46507066-46507088 CTGCTGGTGCAGGTTGTACATGG - Exonic
906719567 1:47995853-47995875 CTGGAGGTGCACCTTGCCCAAGG + Intronic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
907526317 1:55056194-55056216 GTGCTGGGGCTGCTGCCCCAAGG + Intronic
907748416 1:57238162-57238184 ATGCTGATACTGCTGGCCCAAGG - Intronic
909162083 1:72165016-72165038 CTTCTGCTGCAGCAGCCCCAAGG - Intronic
909708630 1:78617782-78617804 CTGCTGCAGAAGCTGGCCCTGGG - Intergenic
913171585 1:116237583-116237605 ATGCTGGTGCTGCTGGTTCATGG - Intergenic
915264655 1:154708111-154708133 CTGCTGCTGCTGCTGGCGCAGGG + Exonic
915325334 1:155078990-155079012 CTGCTGCCGCTGCTGGCCCAAGG + Exonic
915674052 1:157514601-157514623 ATGCTGATGCTGCTGGCCCTGGG - Exonic
915679065 1:157562550-157562572 CTGCTGCTACAGCTGGCTGAAGG - Intergenic
915737628 1:158094847-158094869 CAGCTGGGGCAGCAGGGCCAGGG - Exonic
916513056 1:165490326-165490348 CTGGTGGTTCAGCCAGCCCATGG - Intergenic
916940132 1:169668411-169668433 CTGCTGGTGGAGCTGGCTGCCGG - Intronic
917672676 1:177287853-177287875 ATGCTGATGCTGCTGGTCCATGG + Intergenic
917955821 1:180096986-180097008 CTGCTGGTCCTGCTGGTCCCAGG + Intronic
918113983 1:181482051-181482073 CTGCTGGTGGTGCTGGCTCCTGG - Intronic
918594667 1:186279185-186279207 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
918764178 1:188457310-188457332 TTCCTGGAGCAGCTGCCCCATGG + Intergenic
919085965 1:192920188-192920210 CTGCTGGTGCTGCTAGTCCGGGG + Intergenic
919925289 1:202188889-202188911 CTGCTGCAGCAGCTGCTCCATGG - Intergenic
920281857 1:204849534-204849556 CTGCTGATGCTGCTGGTCCAGGG + Intronic
920339883 1:205269065-205269087 CTTCTGGTGCAGGTGGTCAATGG - Exonic
920339899 1:205269239-205269261 CTTCTTGTGCAGCTGGGCGATGG - Exonic
920662898 1:207933161-207933183 CTACTGATGCTGCTGGCCCAGGG + Intergenic
921135040 1:212252446-212252468 CAGATGCTGCTGCTGGCCCAGGG - Intergenic
921217550 1:212950658-212950680 CTGCTGCTGCTGCTGGGCCTGGG - Exonic
921424123 1:214982809-214982831 ACGCTGATGCTGCTGGCCCAGGG - Intergenic
922033091 1:221823362-221823384 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
922054430 1:222027029-222027051 CTGCTGCTACATCTGTCCCAAGG + Intergenic
922063249 1:222111599-222111621 ATGCAGGTGCTGCTGGTCCAGGG + Intergenic
922665460 1:227465110-227465132 CTGCTGGTAGATCTGACCCATGG - Intergenic
923318579 1:232805795-232805817 TTGCTGCTGCAGCTGCCCCCTGG + Exonic
923521198 1:234736165-234736187 CTGCTGGTCCTCCTCGCCCACGG + Intergenic
923542381 1:234897791-234897813 ATGCTGATGATGCTGGCCCAAGG + Intergenic
923947888 1:238910262-238910284 ATGCTGGTGCTGCTAGACCAGGG - Intergenic
1063140414 10:3251676-3251698 CTGCAGGTGCTGATGGCCCATGG - Intergenic
1063350389 10:5348810-5348832 GTGCTGATGCTGCTGGTCCATGG + Intergenic
1066575472 10:36820030-36820052 CGGCCGGTGCTGCTGGCCCCAGG + Intergenic
1067535584 10:47107510-47107532 CTGCTCAGGCTGCTGGCCCATGG + Intergenic
1067567723 10:47350474-47350496 CTGCGGGCCAAGCTGGCCCAGGG + Exonic
1067696696 10:48541095-48541117 ATGCTGATGCAGCTGGCCCATGG + Intronic
1067791643 10:49292885-49292907 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1068029380 10:51688279-51688301 ATGCTGGTGCTGCTGGTCTAAGG + Intronic
1068773618 10:60849048-60849070 ATGCTGATGCGGCTGGTCCATGG + Intergenic
1069594162 10:69659853-69659875 CAGCTGGTGCAGATCCCCCAGGG + Intergenic
1069854702 10:71433659-71433681 CTGCAGGTGGAGCTGGCTGAGGG - Intronic
1070151424 10:73807635-73807657 CTGCGGGCTCAGCTGGCCGAAGG + Exonic
1071110496 10:82149958-82149980 TTCCTGGCACAGCTGGCCCAGGG - Intronic
1071120365 10:82269824-82269846 ATGCTGATGCTGCTGGTCCAAGG + Intronic
1071358020 10:84817942-84817964 CTGCTGCTGCTGCTGGCACCTGG - Intergenic
1072002831 10:91214383-91214405 CTGCTGCTCCAGCAGTCCCATGG - Intronic
1072096026 10:92180793-92180815 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1072242443 10:93509423-93509445 CTGCTGCTGCTGCTGGCCCTTGG + Intronic
1072895057 10:99359586-99359608 CTGCCGGTGCAGCTCTTCCATGG - Intronic
1074143299 10:110695995-110696017 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1074286279 10:112100895-112100917 CAGCTGGAGCAGCTGGGACATGG + Intergenic
1074310828 10:112321953-112321975 ATGCTGATGCTGCTGGTCCAAGG + Intergenic
1074503470 10:114045471-114045493 CCGCCGTTGCAGCCGGCCCAGGG - Exonic
1074695233 10:116044665-116044687 CTGCTGGTGCACCTTGCCTCAGG + Intergenic
1075070666 10:119318032-119318054 ATGCTGATGCTGCTGGTCCAAGG + Intronic
1075178200 10:120185283-120185305 ATGCTGATGCAGCTGGTCCAGGG - Intergenic
1075188851 10:120287610-120287632 CTGATGTTGCTGCTGGTCCAGGG + Intergenic
1075472639 10:122704424-122704446 CTGCTGCCACCGCTGGCCCAGGG - Intergenic
1076123260 10:127953211-127953233 CTGCTGGGTCATATGGCCCAAGG - Intronic
1076413673 10:130269858-130269880 CTGCTGGAACAGCTTGTCCAGGG + Intergenic
1076847107 10:133074717-133074739 TTTCTGGTGCTGCTGGCCCCCGG + Intronic
1076890116 10:133279224-133279246 CTGCTGCTCCAACTGGTCCAGGG - Exonic
1076894611 10:133303819-133303841 CTGCAGCTCCAGCTGCCCCAGGG + Intronic
1077297421 11:1832630-1832652 GTGCAGGTGCAGCGGGCGCATGG - Intronic
1077402589 11:2366521-2366543 CTGCCAGTGAGGCTGGCCCAGGG + Intergenic
1077495909 11:2886307-2886329 CAGCTGGCGCAGGAGGCCCACGG - Intergenic
1077610918 11:3642602-3642624 ATGCTGGAGCACGTGGCCCAGGG - Intergenic
1078761142 11:14252942-14252964 TTGCTGATGCTGCTGGTCCAAGG + Intronic
1079065930 11:17292580-17292602 ATGCCAGTGCTGCTGGCCCAGGG + Intronic
1080249326 11:30215317-30215339 ATGCTGATCCTGCTGGCCCAGGG + Intergenic
1080774290 11:35371323-35371345 CTGAGGGTCCAGCTGGACCATGG - Intronic
1081722209 11:45298643-45298665 CTGCTGGTGTGGATGGGCCATGG + Intergenic
1082106721 11:48229008-48229030 CTGCTGGTGCTGCAGGCCCAGGG + Intergenic
1082238733 11:49851253-49851275 AGGCTGATGCCGCTGGCCCAGGG + Intergenic
1082243410 11:49893074-49893096 AGGCTGATGCTGCTGGCCCAGGG - Intergenic
1082657906 11:55873900-55873922 AGGCTGATGCCGCTGGCCCAGGG - Intergenic
1083061574 11:59878216-59878238 CTGCTGATGCTGCTGACCCCAGG - Intergenic
1083160296 11:60850273-60850295 CTGCTTCTGCAGCAGGGCCAGGG - Exonic
1083260236 11:61518636-61518658 CAGCTGGTGCCACTGGGCCACGG + Exonic
1083659226 11:64244618-64244640 CTCCTCGTGCCCCTGGCCCAGGG - Exonic
1083883034 11:65557847-65557869 CTGCTGCTGCTGCTGGGCCTGGG - Exonic
1084086587 11:66857760-66857782 CTGCTGCTGCTGCTGGCCAGTGG + Exonic
1084274309 11:68043867-68043889 CTGCTGTTGCAGCTGCTGCAGGG - Exonic
1085782676 11:79423659-79423681 CTCCTGGAGCAGCAGGCGCAGGG + Intronic
1086001618 11:81991140-81991162 CGGCCGGTGCCGCTGGCCCGGGG - Intergenic
1086290183 11:85299796-85299818 ATGCTGGTGTTGCTGGTCCAGGG + Intronic
1086384189 11:86290129-86290151 CTGTTGATGCTGCTGGCCCAGGG + Intergenic
1086690686 11:89786608-89786630 AGGCTGATGCCGCTGGCCCAGGG + Intergenic
1086697836 11:89864898-89864920 AGGCTGATGCCGCTGGCCCAGGG - Intergenic
1086708326 11:89979590-89979612 AGGCTGATGCCGCTGGCCCAGGG + Intergenic
1086715115 11:90053052-90053074 AGGCTGATGCCGCTGGCCCAGGG - Intergenic
1087618979 11:100520951-100520973 ATTCTGGTGCAGTTGGACCAAGG + Intergenic
1088052154 11:105530159-105530181 GTACTGATGCTGCTGGCCCAGGG - Intergenic
1088544434 11:110945652-110945674 CTGCTGGTGGTGGTAGCCCAAGG - Intergenic
1088574040 11:111252413-111252435 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
1089354294 11:117839877-117839899 CTGCTGTTGGGGGTGGCCCACGG - Intronic
1089499666 11:118924941-118924963 TCGCTGCTCCAGCTGGCCCAAGG + Intronic
1090830021 11:130414744-130414766 CTGCTGGTCCAGCTGGTACAGGG + Exonic
1090832336 11:130428210-130428232 CTGCTGCTGCCGCTGGCCCGCGG - Exonic
1091139021 11:133219648-133219670 CTGCTGCTGCTGCCTGCCCAAGG + Intronic
1091970087 12:4779660-4779682 CTGGAGGTGCAGCTGCCACAGGG + Intronic
1092071835 12:5637557-5637579 CAGCTGATGCAGCTGGTCCTTGG - Intronic
1092378452 12:7975256-7975278 ATGCTGATGCTGCTGGTCCATGG - Intergenic
1092778772 12:11966354-11966376 GTGCTGATACAGCTGGTCCAGGG - Intergenic
1092907516 12:13115405-13115427 CCACTGGTACACCTGGCCCATGG + Intronic
1093547915 12:20369510-20369532 CTGCTGGTGAGGCTGGTCCGCGG + Exonic
1094166333 12:27447424-27447446 AGGCTGTTGCAGCTGGTCCATGG - Intergenic
1096617043 12:52839264-52839286 ATGCTGGTGCAGCAGGACCCAGG + Exonic
1096842951 12:54390460-54390482 CTCCTGGTGCCCCCGGCCCAAGG + Intronic
1096928288 12:55173504-55173526 GGGCTGGGGCACCTGGCCCAAGG + Intergenic
1098215063 12:68207138-68207160 CTGCTGGTGTAGCTGTAGCAGGG + Intronic
1101706718 12:107227405-107227427 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1101761794 12:107664748-107664770 CTGCTGCTGCTGCTGGTCCAGGG + Intergenic
1101810046 12:108100051-108100073 TTGCTGGTGGAGCTGACTCATGG - Intergenic
1102202271 12:111065759-111065781 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1102420552 12:112799910-112799932 GTGTTGATGCTGCTGGCCCAGGG + Intronic
1102458946 12:113088133-113088155 TTGGTGGTGCAGCTGGCACTGGG - Intronic
1102553650 12:113711370-113711392 CTTCAGGTGCAGCTGGACCAAGG - Intergenic
1102558499 12:113745565-113745587 CTTCAGGTGCAGCTGGACCCAGG + Intergenic
1102624848 12:114226739-114226761 GCGCTGATGCTGCTGGCCCAGGG + Intergenic
1102751768 12:115300795-115300817 GTGCTGATGCTGCTGGGCCAAGG + Intergenic
1102819891 12:115899116-115899138 CTACTGCTGCAGTTAGCCCAGGG - Intergenic
1103065004 12:117890109-117890131 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1103550285 12:121732200-121732222 CTGCTTGTGAGGCTGGCACAAGG + Intronic
1103618496 12:122170978-122171000 CTGCTGCTGCTGCTGGGCCAGGG + Intronic
1103760890 12:123249581-123249603 CGGCTGGTGCCGCCGGCCCCAGG - Intronic
1104021254 12:124993860-124993882 CTGCTCGGGCTGCTGGCCCCGGG + Exonic
1104794692 12:131509336-131509358 ATGCTGATGCTGCTGGCCCAGGG + Intergenic
1104841623 12:131828567-131828589 CTGCTGCTGCTGCTGGCGCTGGG + Exonic
1104858257 12:131911943-131911965 CAGCTGCTGCATCTCGCCCAGGG - Exonic
1104933805 12:132354033-132354055 CTGCTGGTGGAACGGGGCCACGG - Intergenic
1105014043 12:132775177-132775199 CTGCTGGTTCTGCTGGAGCAGGG + Exonic
1105407083 13:20142068-20142090 CGGCTGGTGCATCTGGGCCGCGG + Exonic
1105701551 13:22938899-22938921 CGGCTGGTGCCGCCGGCCCCAGG - Intergenic
1106197791 13:27509088-27509110 CTGCTGGTGGAGATGCACCAGGG + Intergenic
1106411853 13:29516173-29516195 CTCATGATGCAGCTGGACCAGGG - Exonic
1106473073 13:30075409-30075431 ATGCTGATGCAGCCGGCCCGGGG - Intergenic
1106776730 13:33016498-33016520 CTGCTGGTGCTGCTGGGCCTGGG + Exonic
1107181786 13:37469829-37469851 CTGCCAGTGCAGCTGGAACAAGG + Intergenic
1108002489 13:45916936-45916958 CTGCTGCTGCTGCTGGCCTGGGG - Intergenic
1108016866 13:46085789-46085811 CTGCTGGTGAAGCGACCCCAGGG - Intronic
1108095112 13:46893404-46893426 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1108382687 13:49869234-49869256 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
1108596256 13:51952245-51952267 CTGCTGCTGAAGCTGGCCCTGGG - Intronic
1108596776 13:51956264-51956286 GGGCTGGTGCAGCTGGCCCTGGG - Intronic
1108695636 13:52900190-52900212 CTGCTGCTGCTGCTGGCTTAAGG - Intergenic
1110416265 13:75256541-75256563 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1110495201 13:76160266-76160288 CTGCTGCTGCTGCTGGCCAAAGG + Intergenic
1110667960 13:78140038-78140060 CTGCTTGTGCTGCTAGGCCAGGG + Intergenic
1110712757 13:78667813-78667835 CAGCTGCCGCACCTGGCCCAAGG - Intergenic
1111220895 13:85205011-85205033 CGGCTGGCGCCGCTGGCCCCGGG + Intergenic
1112226159 13:97542518-97542540 ACGCTGTTGCAGCTGGTCCATGG + Intergenic
1112353475 13:98655526-98655548 CTGCTGATGCTGCTGGTCCAGGG + Intergenic
1112365999 13:98756000-98756022 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1112391925 13:98992828-98992850 CTCCTGATGCTGCTGGCTCAGGG + Intronic
1113487836 13:110668034-110668056 ATGCTTCTGCAGCTGGTCCAGGG - Intronic
1113544446 13:111137280-111137302 GTGCTGGTGCTGCTGGTCCTGGG + Intronic
1113930633 13:113967182-113967204 CTCCTGGAGCTGCTGGCCCCAGG + Intergenic
1113989882 13:114352982-114353004 CTGCAGGACCAGCTTGCCCACGG - Intergenic
1114224234 14:20723554-20723576 CTGCCGGGGCAGCCGGCTCAGGG + Intergenic
1114659975 14:24337891-24337913 CTGCTGGAGCAGTGAGCCCAAGG - Exonic
1115749735 14:36477385-36477407 CCTCTGCTGCAGCTGTCCCATGG - Intronic
1116949168 14:50863213-50863235 ATGCTGGTGCAGCTGATCCAAGG + Intronic
1117521295 14:56553802-56553824 ATGTTGGTGCAGCTGGTCTAAGG - Intronic
1117785347 14:59278281-59278303 CTGCGGGTGAACCTGGCTCATGG + Intronic
1118213658 14:63788311-63788333 CTGCAGCTGCAGCTGCACCAGGG + Intergenic
1118327796 14:64793240-64793262 CACCTGGAGCAGCAGGCCCAGGG - Exonic
1118496877 14:66315914-66315936 TTGCTGCTGCACCTGTCCCAAGG + Intergenic
1118626998 14:67668829-67668851 ATGCTGATGCAGCTGGTTCATGG + Intronic
1119499838 14:75115717-75115739 ATGCTGATGCTGCTGGTCCATGG - Intronic
1119767824 14:77201550-77201572 ATGCTGATGCCGCTGGGCCAGGG - Intronic
1120544775 14:85797628-85797650 CAGCTGGTGAAGTTGGCACACGG - Intergenic
1121038779 14:90728152-90728174 CTGCTGGTGCAACTAGCTCAAGG - Intronic
1121432429 14:93897297-93897319 CTGCAGGTACAGCTGGCTCCAGG - Intergenic
1121556627 14:94842783-94842805 ATGCTGATGCTGCTCGCCCATGG + Intergenic
1121906700 14:97752691-97752713 CTGCTGGTCCTGCTGGCTCTGGG - Intronic
1122407946 14:101511566-101511588 CTTCTGCTGCAGCTGGCCTTAGG - Intergenic
1122514525 14:102297784-102297806 CAGCTGGTGCTGCTGGCCCCGGG + Intronic
1122714817 14:103689657-103689679 GTGCTGGGGCTGCTGGCCCGGGG + Intergenic
1122738701 14:103858490-103858512 CTGCTGATGCTGCTGGTCCAGGG + Intergenic
1122837148 14:104435923-104435945 CAGCTGGTGCAGATGGTCCCAGG + Intergenic
1123406295 15:20021058-20021080 GTGCTGGTGCTGCTGGGTCAGGG + Intergenic
1123515625 15:21027706-21027728 GTGCTGGTGCTGCTGGGTCAGGG + Intergenic
1123943525 15:25228021-25228043 CTGGTGGTGCTGCAGGCCCTGGG + Intergenic
1124269349 15:28266570-28266592 CTTCTGTTGCAGATGGACCATGG - Intronic
1124291346 15:28456066-28456088 GTGCTGGACCAGCTGGGCCAGGG - Intergenic
1125511999 15:40297131-40297153 CTCCTGGTGCAGATGGCCTTGGG - Intronic
1125727786 15:41876910-41876932 GTGCTGCTGCAGCAGGCTCAGGG + Exonic
1126416255 15:48420723-48420745 CTACAGGTGCAGCTGCCCCCAGG - Exonic
1126580668 15:50239836-50239858 CTGCTGATGCTGCTGGCTCAGGG - Intergenic
1126780309 15:52133982-52134004 CTGAGGGTGCAGATGGCCCGGGG - Intronic
1126924063 15:53562492-53562514 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1127374786 15:58374476-58374498 TTGCTGGCAGAGCTGGCCCAGGG + Intronic
1127557164 15:60099074-60099096 CAGCTGATGTAGCTTGCCCAAGG + Intergenic
1127904956 15:63369613-63369635 ATGCTAATGCTGCTGGCCCAGGG + Intronic
1127916436 15:63459184-63459206 CGGCCGGTGCTGCTGGCCCTGGG + Intergenic
1127918378 15:63473940-63473962 CTGGTGTTGCAGCTAGCCCTGGG + Intergenic
1128080986 15:64856799-64856821 CAGTTGGTGGACCTGGCCCAGGG + Intronic
1128231547 15:66038995-66039017 CTGCTGGTGCTGCTGGCCTGGGG - Intronic
1128338529 15:66803669-66803691 CTGCTGATGCTGCTGGTTCAGGG - Intergenic
1128378223 15:67092428-67092450 ATGCTGACGCTGCTGGCCCAGGG - Intronic
1128498264 15:68210444-68210466 CTCCTGGCTCAGCTGGTCCAGGG - Intronic
1128575351 15:68770584-68770606 CTGCTGGTGCAGCAGGGCTAGGG - Intergenic
1128615258 15:69103904-69103926 GTGCTGATGCTGCTGGTCCAAGG + Intergenic
1128798780 15:70483678-70483700 CTGCTTGAGCAGATGGCCTAGGG + Intergenic
1128867903 15:71129186-71129208 CTCCTGCTGCTGATGGCCCAAGG - Intronic
1128941011 15:71787643-71787665 ATGCTGATGCTGCTGGTCCAAGG + Intergenic
1129032182 15:72627502-72627524 ATGCTGATGCTGCTGGCTCAGGG - Intergenic
1129186200 15:73908515-73908537 GAGCAGGTGCAGCAGGCCCAGGG + Intergenic
1129217715 15:74109737-74109759 ATGCTGATGCTGTTGGCCCAGGG + Intronic
1129406948 15:75326240-75326262 ATGCTGATGTTGCTGGCCCAGGG - Intergenic
1129470154 15:75749110-75749132 ATGCTGATGCTGCTGGCTCAGGG - Intergenic
1129734876 15:77954032-77954054 ATGCTGATGCTGCTGGCTCAGGG + Intergenic
1129756999 15:78104778-78104800 CTGTGGGTGCAGTGGGCCCAAGG - Exonic
1129840715 15:78741959-78741981 ATGCTGATGCTGCTGGCTCAGGG - Intergenic
1130137752 15:81196109-81196131 CTGCTGATGCAGCTGGCTTGAGG + Intronic
1130380481 15:83367932-83367954 ATGCTGATGCTGCTGGCCCCTGG + Intergenic
1131208253 15:90470475-90470497 ATGTTGATGCTGCTGGCCCAAGG + Intronic
1131670055 15:94610340-94610362 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1132250222 15:100330430-100330452 ATGCTGATGCTGCTGGCCCGGGG + Intronic
1132605656 16:792729-792751 CTGCTGCTTCAGCTGCCGCAGGG - Exonic
1132733785 16:1375770-1375792 CTCTGGGTGCGGCTGGCCCAAGG - Intronic
1132804281 16:1768529-1768551 AGGCAGGGGCAGCTGGCCCAGGG - Exonic
1133152823 16:3849761-3849783 CTGCTGCTGCTGCTGGTCCAGGG + Intronic
1133292947 16:4734707-4734729 CTGCAGGCGCAGCAGGCCCGAGG - Intronic
1133492898 16:6288713-6288735 CTGCTGGTACAGCTGAAGCAAGG + Intronic
1133907528 16:10035665-10035687 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1133911513 16:10070309-10070331 ATGCTGATGCTGCTGGCCCATGG - Intronic
1134313326 16:13095964-13095986 ATGCTGTTGCTGCTGGTCCAAGG + Intronic
1134419799 16:14075607-14075629 ATGCTGATGCTGCTGGTCCAAGG + Intronic
1134438335 16:14282115-14282137 ATGCTGCTGCAGCTGGTCCAGGG - Intergenic
1135046318 16:19158913-19158935 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1135189274 16:20341600-20341622 CTGCTGATGCTGCTGGTCTATGG + Intronic
1135733086 16:24910408-24910430 CTGCTGCTGCTGCTGGCCTCTGG - Exonic
1135747729 16:25031715-25031737 CTGCTGGGGCAGCCGGCCTCCGG + Intergenic
1136707432 16:32201605-32201627 GTGCTGGATCAGCTGGGCCAGGG + Intergenic
1136746714 16:32597373-32597395 CTGGTGGAGCAGCTGGCCCATGG - Intergenic
1136760479 16:32727812-32727834 GTGCTGGGTCAGCTGGGCCAGGG - Intergenic
1136807624 16:33142574-33142596 GTGCTGGGTCAGCTGGGCCAGGG + Intergenic
1136996792 16:35196091-35196113 CTGCTGGTGCCGCTCGGGCAGGG - Intergenic
1137396162 16:48117410-48117432 CTGCTGGTGTTGCTGGGGCAAGG + Intronic
1137652832 16:50135100-50135122 CTGCTGGATCATATGGCCCAAGG + Intergenic
1138095978 16:54212305-54212327 CTACTGATGCTGCTGGCCCAGGG + Intergenic
1138383339 16:56618590-56618612 CTGCTGCTCCTGCTGCCCCATGG + Intergenic
1138386154 16:56636853-56636875 CTGCTGCTTCTGCTGCCCCATGG + Intergenic
1138387356 16:56644711-56644733 CTGCTGCTCCTGCTGCCCCATGG + Intronic
1138432438 16:56977663-56977685 CTGCTGTAGCAGCTGGGCTAGGG - Intronic
1138645149 16:58419242-58419264 GTGCTGATGCAGCTGGCCTGGGG - Intergenic
1138659501 16:58509029-58509051 ATGCTAGGGAAGCTGGCCCAGGG - Intronic
1139134603 16:64186896-64186918 CTGCTGGATCATATGGCCCAAGG - Intergenic
1139229818 16:65272881-65272903 ATGCTGATTCAGCTGGTCCAAGG - Intergenic
1139706950 16:68747343-68747365 CTGCAGAGGCAGCTGGGCCAGGG + Intronic
1139930114 16:70519453-70519475 ATGCTGGTACAACTGGTCCAAGG + Intronic
1140584547 16:76274387-76274409 ATCCTGATGCAGCTTGCCCAAGG + Intergenic
1141128309 16:81416942-81416964 CTGCTGCTGCCGCCGGCCCGAGG - Intergenic
1141336332 16:83158693-83158715 CTGGTGCTGCAGCTGCTCCATGG + Intronic
1141370460 16:83481706-83481728 CTGCTAGTTCATCTGGCTCAGGG + Intronic
1141425825 16:83943813-83943835 CTGCTGCTGCTGCTGCTCCAGGG + Intronic
1141928323 16:87183833-87183855 CAGGTGGTGCAGCTGGCAGAGGG - Intronic
1142307858 16:89295549-89295571 GTGCTGGTGCTGCTGGAGCACGG + Intronic
1142374154 16:89698148-89698170 CAGCTGGTGCAGGTGGCCCTGGG - Exonic
1203048843 16_KI270728v1_random:856577-856599 CTGGTGGAGCAGCTGGCCCATGG - Intergenic
1203062632 16_KI270728v1_random:988127-988149 GTGCTGGGTCAGCTGGGCCAGGG - Intergenic
1143364895 17:6400627-6400649 CTGCCAGTGCAGCTAGCACAAGG + Intronic
1143631606 17:8143323-8143345 CTGCTGTTGCAGGAGGCCCTGGG - Exonic
1143774119 17:9186548-9186570 CTGCTGGGGCAGTTAGCCAAAGG - Intronic
1143945999 17:10592612-10592634 GTGCTGATGCTGCTGGCCCATGG - Intergenic
1144088587 17:11833067-11833089 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1144099389 17:11930585-11930607 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1144146664 17:12405474-12405496 ATGCTGATGCTGCTGGCCCGTGG - Intergenic
1144194243 17:12875213-12875235 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1144327462 17:14195810-14195832 CTGCTGATGCCCCTGGTCCAGGG + Intronic
1145980035 17:29005814-29005836 CTGCTGGCGCTCCTGGCTCACGG - Exonic
1146521574 17:33529405-33529427 ATGCTGATGCCGCTGGCCCAGGG - Intronic
1148084491 17:44985721-44985743 CTGCTAGTTCAGCTGGTCGATGG - Intergenic
1148086759 17:44998352-44998374 GTGCTGGTGCTCCTGGCCCTTGG - Intergenic
1148133122 17:45274226-45274248 CTCCTTGACCAGCTGGCCCAGGG + Exonic
1148549194 17:48540316-48540338 GTGCTGATGCTGCTGGTCCATGG + Intergenic
1148820024 17:50354875-50354897 GAGGTGGTGGAGCTGGCCCAGGG + Exonic
1148874587 17:50679418-50679440 ATGGTGATGCAACTGGCCCATGG - Intronic
1150441580 17:65195873-65195895 CTGCGGATGCCGCTGGTCCAGGG - Intronic
1151324287 17:73369340-73369362 CTGCTGGTGCAGCGGGCCCGGGG - Intronic
1151562529 17:74878257-74878279 CTCCTGCTGCTGCTGGTCCAGGG - Exonic
1152147036 17:78574604-78574626 CTGCAGCTGCTGCTGGCCCAGGG + Intronic
1152348722 17:79771029-79771051 CTGCTGATGCAGCAGGGACATGG + Intergenic
1152862708 17:82705160-82705182 CTGCAGGGCCAGATGGCCCATGG - Intergenic
1152914009 17:83023360-83023382 ATGCTGGTGCAGGTGGGCCGGGG - Intronic
1153555595 18:6310081-6310103 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1153689131 18:7573918-7573940 ATGCTGATGCTGCTGGCTCAAGG - Intronic
1153868696 18:9297035-9297057 CGGCTGGTGCCACTGGCCCCAGG + Intergenic
1154205793 18:12335643-12335665 CTGCAAGTGCAGCAGGCTCAGGG + Intronic
1156038196 18:32789522-32789544 TTGCAGTTGCAGCTGGCCAAGGG + Intergenic
1156367183 18:36440169-36440191 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1156371212 18:36473099-36473121 AAGCTGGTGGTGCTGGCCCAAGG - Intronic
1156572804 18:38278545-38278567 CTGGTGGTGCTGCTGGTCCTTGG + Intergenic
1157226318 18:45868253-45868275 ATGCTGATGCTGCTGTCCCAGGG + Intronic
1157685575 18:49640166-49640188 CTTCTGCTCCGGCTGGCCCAAGG + Intergenic
1157710435 18:49846357-49846379 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1158316106 18:56212823-56212845 CTGCTGCTTTATCTGGCCCAAGG - Intergenic
1158480997 18:57821751-57821773 CTGCTGCTGCTCCTGGTCCAGGG - Intergenic
1158725679 18:59969578-59969600 CTCCCGGAGCAGCTGGCCCTCGG - Intergenic
1159277119 18:66235362-66235384 CTGCTGGATCATATGGCCCAAGG - Intergenic
1160234649 18:77076423-77076445 CTGCAGGTGCAGCTGGGCCAGGG - Intronic
1160532615 18:79574371-79574393 CTGCGTGTGCCGCTGGCCCCTGG + Intergenic
1160543936 18:79640543-79640565 CTCCAGGTGCAGCTGCCTCAAGG + Intergenic
1160675851 19:390911-390933 CTGGAGGTGCCGCTGGCCCTGGG - Intergenic
1160841813 19:1149765-1149787 CTGGGGGTGCCGCTGGCCCCGGG + Intronic
1161272413 19:3397401-3397423 CCGCAGGTTCAGCTGGCTCAAGG + Intronic
1161304031 19:3557195-3557217 CTGCTGGGCCAGGTGGCCGACGG - Exonic
1162043843 19:7985903-7985925 CTGATGCTGCTGCTGGCCCAGGG + Intronic
1163099073 19:15082662-15082684 ATGCTGGTGCTTCTAGCCCAGGG - Intergenic
1163155962 19:15440095-15440117 CTGCTGGAGGAGGTGGCCGAAGG - Intronic
1163216831 19:15885322-15885344 CTGGTGGTGGAGCTGTCCCTGGG - Intronic
1163540910 19:17909632-17909654 CTTCAGGTGCAGCTGGCTCCAGG + Intergenic
1164947099 19:32305080-32305102 ATGCTTATGCAGCTGGTCCATGG - Intergenic
1165013027 19:32862460-32862482 GGGCTGGTGCTCCTGGCCCAAGG - Exonic
1165111224 19:33503532-33503554 CTTATTGTGCAGCTGGCTCAAGG + Intronic
1165452254 19:35890402-35890424 CTGCTGCTGGAGCTGCCCCGGGG - Exonic
1166059431 19:40316408-40316430 ATGGTGGTGCAGCGAGCCCAGGG - Intergenic
1166118137 19:40668005-40668027 CTGCTGCTGCTGCTGGGCCTTGG + Exonic
1166733394 19:45071009-45071031 CAGCTGGCTCTGCTGGCCCATGG - Intergenic
1166748342 19:45152520-45152542 CTGCTGCTGCAGCAGGCGCACGG + Exonic
1166959714 19:46490092-46490114 CTGCTGCTGCTGCAAGCCCACGG + Intronic
1167732051 19:51265535-51265557 CTGATGGTGCTGTTAGCCCAGGG - Exonic
1167734328 19:51282655-51282677 CTGATGGTGCTGTTGGCCCAGGG - Intergenic
1168016121 19:53574508-53574530 CTGCTGGTGCTGCTGGTCTGTGG + Intronic
1168240518 19:55086749-55086771 CTGCAGGCGCGCCTGGCCCAGGG + Exonic
1168269434 19:55241571-55241593 CAGCTGGAGCTCCTGGCCCAGGG - Exonic
1168335886 19:55597572-55597594 CTGGTGGTGCAGCAGGCCGGTGG + Exonic
1168409002 19:56127014-56127036 CAGCTGCAGCAGCTGGCACACGG - Intergenic
1168566003 19:57424351-57424373 CTCCTGGTGAAGCTTTCCCATGG + Intronic
1168694129 19:58395518-58395540 ATCCTGGTGGGGCTGGCCCAGGG + Intergenic
925413960 2:3656630-3656652 ATGCTGGGGCTGCTGGGCCATGG - Intergenic
925713823 2:6767217-6767239 GTGCTGGGGACGCTGGCCCAGGG + Intergenic
925997926 2:9307051-9307073 CTGCTGGTGCAGCTGGCCCAGGG - Intronic
926172384 2:10560511-10560533 CTGCTGCTGCAGCTGGCCTGGGG - Intergenic
926408922 2:12581683-12581705 CTGCTGGGTCATATGGCCCAAGG - Intergenic
926552223 2:14314644-14314666 CTTCTGGTGCAGGTGACCAATGG + Intergenic
927553840 2:24019218-24019240 TTGCTGATGCTGCTGGTCCAGGG - Intronic
927651892 2:24918343-24918365 CTCCTGCTGCTGCTGGGCCACGG + Exonic
927684477 2:25161185-25161207 CCGCTGGGGCAGCCCGCCCAAGG - Exonic
927911797 2:26904952-26904974 CTTCTGGTCCAACTGGCCCTGGG - Intronic
928317198 2:30255506-30255528 CTGGTTGTGCAGCTGGCTTAAGG + Intronic
928599205 2:32886829-32886851 CGGCCGGTGCCGCTGGCCCCAGG - Intergenic
928618749 2:33067807-33067829 CTGCTGGTACAGCTGTCCCCTGG - Intronic
929536518 2:42787546-42787568 TGGCTGGTTCTGCTGGCCCAGGG + Intronic
930635563 2:53801781-53801803 CTGCTGCTCCAGCTGCCTCAGGG - Exonic
930804742 2:55479161-55479183 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
930839131 2:55826033-55826055 GTGTCTGTGCAGCTGGCCCAAGG - Intergenic
931700122 2:64902545-64902567 ATGCCGATGCTGCTGGCCCAGGG + Intergenic
931778853 2:65563043-65563065 CCGCTGGTGTAACTGGGCCAAGG + Intergenic
932347244 2:71003763-71003785 CTCCTGGTGCAGCTTCCCCCAGG + Intergenic
932347571 2:71005701-71005723 CTCCTGGTGCAGCTCCCCCCAGG + Intergenic
932371232 2:71189893-71189915 CTGCTGTTGCAACTGTCCCATGG + Exonic
932416745 2:71578200-71578222 ATGCTGATGCTGCTGGTCCAGGG + Intronic
932456942 2:71855952-71855974 CTGGGGATGCAGCCGGCCCAAGG + Intergenic
932712471 2:74077362-74077384 ATGCTGATGCTGCTGGCCCTGGG + Intronic
932753751 2:74390696-74390718 ATGCTAATGCTGCTGGCCCATGG - Intronic
933600284 2:84321937-84321959 ATGCTGATGCTGCTGGGCCATGG + Intergenic
933891845 2:86779027-86779049 ATGCTGATGCTGCTGGTCCATGG - Intergenic
934588393 2:95525993-95526015 AGGCTGATGCCGCTGGCCCAGGG + Intergenic
934733420 2:96673737-96673759 ATGCGGATGCTGCTGGCCCAGGG - Intergenic
935433638 2:103004515-103004537 CTGCAGGTGGAGGTGGCCCCAGG - Intergenic
935557493 2:104526258-104526280 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
935646625 2:105341780-105341802 GTGCTGGTGCTGCTGGTCCCTGG + Intronic
936400273 2:112159707-112159729 CAGCTGCTGCAGCTGGCGGATGG - Exonic
937029359 2:118725256-118725278 CTGCTGGAGAGGCTGGGCCAGGG - Intergenic
937814508 2:126236688-126236710 GTGCTGGTGCTGCAGGTCCAAGG - Intergenic
937831716 2:126431506-126431528 AGGCTGGTGCTGCAGGCCCAAGG + Intergenic
938590325 2:132729615-132729637 ATGCTGATGATGCTGGCCCATGG + Intronic
938922729 2:136009772-136009794 CTGCTGCTGCTGCTGGTCCAGGG + Intergenic
939986346 2:148833161-148833183 CTGCTGGTGCTGCTGGCCCATGG + Intergenic
941291037 2:163675418-163675440 ATGCTGTTGCTGCTGGTCCAGGG - Intronic
941531360 2:166675240-166675262 CTGCTGTTCAAGATGGCCCAGGG - Intergenic
941594455 2:167457778-167457800 CTGCCGGTGCTGCTGGTTCACGG - Intergenic
941746761 2:169095196-169095218 ATGCTGATGCTGCTGGTCCAGGG - Intronic
942364366 2:175208008-175208030 GTGCTGGTGCTGCTGGTCCAGGG + Intergenic
942513569 2:176728266-176728288 CTGCAGATGGAGCTGGTCCACGG - Intergenic
942521224 2:176806270-176806292 CTACTGCTGCTGCTGGCGCATGG - Intergenic
942620011 2:177835772-177835794 CAGCTGGTGCCGCCGGCCCTGGG + Intronic
943042473 2:182820099-182820121 CTGCTGGTGCAGCTGCGCTCTGG + Intergenic
943394636 2:187318732-187318754 ATGCTGATGCACCTGGACCAGGG - Intergenic
944483253 2:200178493-200178515 CTGCTGCTGCCTGTGGCCCATGG + Intergenic
945435825 2:209816631-209816653 ATGCTGATGCTGCTGGTCCAGGG + Intronic
945446254 2:209941738-209941760 ATGCTGATGCTGCTGGCCCAGGG - Intronic
945860294 2:215113530-215113552 ATGCTGATGCAGCTGGTCCATGG + Intronic
946117546 2:217476644-217476666 GAGCTGCTGCAGCTGGCTCATGG + Intronic
946462133 2:219878027-219878049 CTCCTGGTGCAGCCCACCCAAGG - Intergenic
947646868 2:231748754-231748776 CGGCTGGAGCAGCTGGGACATGG - Intronic
947861093 2:233357867-233357889 ATGCTGATGCTGCTGGTCCATGG + Intronic
1168850203 20:971325-971347 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1168953690 20:1819672-1819694 GTGCCGGTGCAGGTGGCCCATGG + Intergenic
1168958885 20:1854762-1854784 CTGCTGCTGCTGCTGGTCCTGGG - Intergenic
1168974078 20:1951117-1951139 CTGCTGGTCCAGCCGATCCATGG + Intergenic
1169748384 20:8965935-8965957 ATGCTGTTGCTGCTGGTCCAGGG - Intronic
1169847726 20:10013775-10013797 ATGCTGTTGCTGCTGGTCCAAGG - Intronic
1170009274 20:11703788-11703810 ATGCTGATGCAGCTGGTCCAGGG - Intergenic
1170161676 20:13319800-13319822 CTGATGCTGCTGCAGGCCCAGGG - Intergenic
1170479591 20:16752847-16752869 CTGCTGCTGCTGCTGGTCCAGGG - Intronic
1170649071 20:18223436-18223458 CTTCTGGGGCACCTGACCCAAGG - Intergenic
1171231967 20:23493952-23493974 CTGCTGCTGCTGCTGGCCTTAGG + Intronic
1171377675 20:24704491-24704513 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
1171381553 20:24737750-24737772 ATGCTGGTGCAGCAAACCCAGGG - Intergenic
1171409649 20:24937305-24937327 ACGCTGGTTCTGCTGGCCCAGGG + Intergenic
1172045430 20:32076743-32076765 CTGCTGCTGCTGCTGCTCCAGGG + Intronic
1172473381 20:35218104-35218126 CTGCTGCTCCTGCTGCCCCATGG + Intergenic
1172970934 20:38872628-38872650 CTGCTGCTGCTGCTGGTCCAGGG + Intronic
1173174562 20:40754621-40754643 TTCCTGGTCCAGATGGCCCACGG + Intergenic
1173300454 20:41797766-41797788 TTGCTGATGCCGCTGGCCCAGGG + Intergenic
1173606359 20:44334565-44334587 CTGCTTCGCCAGCTGGCCCAGGG + Intergenic
1173690880 20:44960206-44960228 CTGCGGGTGCTGCAGGCGCAAGG - Exonic
1173767776 20:45629853-45629875 GTGCTGCTGCTGCAGGCCCAGGG + Exonic
1173773798 20:45685931-45685953 GTGCTGCTGCTGCAGGCCCAGGG - Intronic
1174624726 20:51904635-51904657 CTGCTGATGCTGCTGGTCTATGG - Intergenic
1174797166 20:53531797-53531819 TTGCTGGCGCTGCTGACCCAGGG - Intergenic
1174943646 20:54960358-54960380 CTGCTGCAGCTGCTGGTCCAGGG - Intergenic
1175166052 20:57045472-57045494 CTGCTGATGCTGCAGGCCCGGGG - Intergenic
1175204773 20:57303108-57303130 CTGCAGGTGCAGATGTTCCAAGG - Intergenic
1175315567 20:58044393-58044415 CTGCTGGTGCCTCTGGGCCTCGG - Intergenic
1175362637 20:58425692-58425714 CTGCTGCTGCTGCTGGCCCAGGG - Intronic
1175872836 20:62216551-62216573 CTGCTGGGGCTGCTGGCAGAAGG - Exonic
1175894740 20:62331056-62331078 CTGCTGATGCAGCTGACCCGGGG + Exonic
1176060024 20:63168439-63168461 CCTCAGGTGCAGCTGGCTCAGGG + Intergenic
1176146876 20:63569415-63569437 CTGGGGCTGCAGCTGGGCCAGGG - Exonic
1178733552 21:35128753-35128775 CTGCTGGTGCAAGTAGGCCAAGG - Intronic
1179026443 21:37682842-37682864 CTGCAGGGACAGATGGCCCAGGG - Intronic
1179122613 21:38562429-38562451 CTGCTGGTTCTGCTGGCCTGAGG - Intronic
1179198004 21:39183637-39183659 CTGCGGGGACTGCTGGCCCAGGG - Exonic
1180087475 21:45514433-45514455 CTGCTGGAGCTGCTGGACCCAGG - Exonic
1180204139 21:46246876-46246898 ATGCTGTTGCAGGTGGCCCATGG - Exonic
1180245577 21:46545396-46545418 CTGCTGGGGCTGTTGGCACATGG + Intronic
1181056157 22:20261400-20261422 CTCCTGGTGCACCTGGCTCCAGG - Intronic
1181277617 22:21696471-21696493 CTGCTGATGCAGCTGGCCCAAGG - Intronic
1181495255 22:23283963-23283985 CTGCCGGTGCTGCAGGCACAGGG - Exonic
1181497018 22:23293016-23293038 CTGCTGGTGGGGCTGGGACAGGG + Intronic
1181531480 22:23519974-23519996 CTGCTTGTGCATCTGGACGACGG - Intergenic
1181672199 22:24430906-24430928 CTGCTGGTGGTGCTGGGCCTGGG + Intronic
1181720251 22:24768723-24768745 CTGCAGGTGGAGGAGGCCCAAGG + Intronic
1181848920 22:25735852-25735874 CTGCAGGAACAGCTGGCTCAAGG - Intergenic
1181856787 22:25787408-25787430 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1181913165 22:26256682-26256704 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1182301061 22:29337432-29337454 CTGCAGGTGCAGCTGGCATATGG + Intronic
1182301141 22:29337808-29337830 GTGCTGGGGCAGCTGGACCACGG - Intronic
1182576648 22:31277254-31277276 CTCCTCGTGCCCCTGGCCCAGGG + Exonic
1183093110 22:35536838-35536860 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
1183314383 22:37128941-37128963 CTCCTGAAGCAGTTGGCCCAGGG + Intronic
1183356927 22:37364580-37364602 CTGCTGGCTCTGGTGGCCCATGG - Intergenic
1184069336 22:42138381-42138403 CGGCTGGTGCCTCTGGCCCCAGG + Intergenic
1184171845 22:42764662-42764684 CCGATGGAGAAGCTGGCCCATGG - Intergenic
1184735047 22:46393114-46393136 CTGCAGATGCGGCTGGCCCTAGG - Intronic
1185088507 22:48753345-48753367 CTGGTGGCTCAGCTGGCCCAGGG - Intronic
1185314948 22:50174947-50174969 CTGCAGGTGCAGCGGGTCCAGGG + Intronic
949371295 3:3337410-3337432 ATGTTGATGCTGCTGGCCCAGGG + Intergenic
949468595 3:4369790-4369812 CTGCTGATGCTACAGGCCCATGG + Intronic
949830002 3:8204117-8204139 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
949894623 3:8760042-8760064 CTGCAGGTCCAGTTGGCGCATGG - Intronic
949898987 3:8794153-8794175 ATGCCAGTGCAGCTGGCCCATGG - Intronic
949961712 3:9317773-9317795 ATGCTGATGCTGCTGGTCCAGGG + Intronic
950010096 3:9716879-9716901 ATGCTGATGCTGCTGGCTCATGG - Intronic
950256789 3:11512357-11512379 CTGGTGCTGCAGCTTGGCCAAGG + Intronic
950494370 3:13324811-13324833 CTGCTGCTGCTGCTGTTCCAGGG - Intronic
950589912 3:13929701-13929723 CAGCAGGGGCAGCTGGCCCTAGG - Intergenic
950660904 3:14466552-14466574 CTCCTGGTGCTGCTGGTCCGAGG + Exonic
950803315 3:15573736-15573758 GTGCTGATGCGCCTGGCCCAGGG + Intronic
951068044 3:18290537-18290559 ATGCTGTTGCTGCTGGTCCAGGG + Intronic
951689572 3:25381704-25381726 ATGCTGATGCTGCTGGTCCAAGG - Intronic
951695122 3:25438301-25438323 CTGCTGGTGAAGCAGACACAGGG + Intronic
951849803 3:27126556-27126578 CTGCTGCTGCTGCTGATCCAGGG - Intronic
952329635 3:32352376-32352398 ATGCTGATGCTGCTGGCTCAGGG - Intronic
952351486 3:32543121-32543143 ATACTGGTGCTGCTGGTCCAGGG + Intronic
952583979 3:34869227-34869249 CTGCTGATGCTGCTGGTCTAAGG - Intergenic
952835032 3:37595257-37595279 CTGGTGGTGGAGCTGGCCATAGG - Intronic
953199999 3:40770064-40770086 ATGCTGATGCTGCTGGCCCTGGG - Intergenic
953223504 3:40996547-40996569 TAGCAGGTGCAGCTGGCCCCAGG - Intergenic
953735356 3:45489521-45489543 CTGCTAATGCTGCTGGTCCAGGG + Intronic
953796405 3:45989401-45989423 CTGGAGGTCCTGCTGGCCCAGGG + Intronic
954365782 3:50145312-50145334 CTGGTGGGGCAGCTGGGGCAAGG + Intergenic
954384745 3:50238165-50238187 CTGCTGCTGCTGCTGCCCGACGG + Intronic
954892264 3:53941665-53941687 CTCACGGTGTAGCTGGCCCATGG + Intergenic
955531157 3:59874511-59874533 ATGCTGATGCTGCTGGTCCAGGG + Intronic
955837061 3:63067662-63067684 ATGCTGATGTTGCTGGCCCATGG - Intergenic
956165363 3:66394466-66394488 ATGCTGGGGCTGCTGACCCAAGG + Intronic
956725332 3:72152207-72152229 ATGCTGGTGCCGCTAGTCCAGGG - Intergenic
957840042 3:85655871-85655893 ATGCTGTTGCAGCTGGTCCAAGG + Intronic
957856762 3:85889409-85889431 TTTCTGGTGGAGCAGGCCCACGG + Intronic
958023832 3:88027405-88027427 CTGCTGCTGCAGTTGGCCTGAGG + Intergenic
958428622 3:94009995-94010017 ATGCTGATGCAGGTGGTCCATGG - Intronic
958882737 3:99691471-99691493 ATGCTGATGCTGCTGGTCCATGG - Intronic
959462444 3:106643869-106643891 CAGCTGGTGCTGCTGGCCCTGGG + Intergenic
959825921 3:110795561-110795583 CTGCTGATGCTGCAGGTCCAGGG + Intergenic
959931461 3:111987924-111987946 CTGCTGCTGCTGCTAGCCTAGGG - Intronic
960142955 3:114168713-114168735 GTGTTGGTTCAGCTGCCCCATGG - Intronic
960171095 3:114461701-114461723 ATGCTGATGCTGCTGGCCCAAGG - Intronic
960639412 3:119811925-119811947 ATGCTGATGCTGCTGACCCAGGG - Intronic
961125697 3:124415789-124415811 ATGCTGGTGCTGCTGGGCCCAGG - Intronic
961520866 3:127466731-127466753 CTGCTGGTGAAGTTGGCCTCGGG - Intergenic
961612271 3:128149736-128149758 CTGGTTGTGTGGCTGGCCCAAGG - Intronic
962364067 3:134765778-134765800 ATGCTGATGCTGCTGGCCAAAGG - Intronic
962425029 3:135262137-135262159 CTGCTGATGCTGCTGGTCCAGGG + Intergenic
962990399 3:140572617-140572639 CAGGTGATGCAGCTGGCCCAGGG - Exonic
963124527 3:141802878-141802900 CTGCTGGTTCATCAGGCACAAGG - Intronic
963430005 3:145188606-145188628 CTGCTGGTGCTGCTGGCCTGTGG - Intergenic
963728368 3:148946973-148946995 CTTATGGAGCAGCGGGCCCACGG - Intergenic
964503263 3:157371491-157371513 ATGCTGATGCCGCTGGTCCAGGG - Intronic
965507466 3:169532272-169532294 ATGCTGATGCTGCTGGCCCAGGG + Intronic
965641006 3:170829018-170829040 ATGCTGATGCTGCTGGTCCAGGG - Intronic
966627369 3:182032864-182032886 CTTCTGATGCAGATGGCCAATGG - Intergenic
967113196 3:186313571-186313593 ATGCTGATGCTGCTGGTCCAGGG - Intronic
967319567 3:188182234-188182256 ATACTGATGCTGCTGGCCCAAGG - Intronic
967874640 3:194259272-194259294 ATGCTGATGCTGCTGGCCCATGG + Intergenic
968019018 3:195367271-195367293 GTGCTGATGCTGCTGGTCCAGGG + Intronic
968286135 3:197509976-197509998 CTCCTGGGGCAGCTGGGACAGGG + Exonic
968441178 4:625259-625281 CTGCTGGTGGAGCTGCCTGAGGG - Intergenic
968646162 4:1741629-1741651 CTGCAGGTGCAGCTGGAAGAGGG + Intronic
968933151 4:3594760-3594782 CTGTTTGTGAAGCTCGCCCAGGG + Intergenic
969319433 4:6402835-6402857 CAGCTGGAGCACCTGTCCCATGG + Intronic
969454088 4:7291321-7291343 CTGCAGGTGCAGACGGGCCACGG + Intronic
969954726 4:10877168-10877190 ATGCTGATGCTGCTGGCCCAAGG - Intergenic
970615768 4:17767068-17767090 CGGCTGGCGCTGCTGGCCCCAGG - Intronic
971792367 4:31185227-31185249 CAGCTGGTGCCGCCGGCCCCAGG - Intergenic
972144036 4:35999111-35999133 ATGCTGGTGCTTCTGGCTCAGGG - Intronic
972960375 4:44447057-44447079 CTGTTGGTGCAGCTGCCGCGCGG - Intronic
973605101 4:52579066-52579088 CTGCTGGTGCTGCTGGTGCTGGG + Intergenic
974147409 4:57965524-57965546 CGGCTGGTCCTGCTGGCCCCAGG + Intergenic
974299262 4:60042479-60042501 CAGCTGGAGCCGCCGGCCCAGGG - Intergenic
975028061 4:69576595-69576617 CTGCTGGTGCCGCCCGCCCTGGG - Intergenic
975417138 4:74117704-74117726 CTGCTTCCGCAGCAGGCCCAGGG + Intronic
975713856 4:77187135-77187157 CTCCTGCTGTAGCTGGCCCCAGG + Intronic
976164713 4:82242014-82242036 ATGCTGATGCTGATGGCCCAAGG - Intergenic
977152409 4:93529368-93529390 GTGCTGATGCAGCTGGACCAGGG - Intronic
978985269 4:115004431-115004453 CTGCTTTTGCAGCTGGCTCATGG + Intronic
979131315 4:117049182-117049204 ATACTGGTGAAGCTGGCACAGGG + Intergenic
980923773 4:139114794-139114816 CTCCTCGTGCCCCTGGCCCAGGG - Intronic
981615427 4:146639264-146639286 CTGCTGGGGGAGCTGGCCGAGGG - Exonic
982121277 4:152145747-152145769 CAGCTGGAGCAGCTGGGACATGG + Intergenic
982146150 4:152395279-152395301 CTTCTGATGCAGCTGGTCCAAGG + Intronic
982597798 4:157407192-157407214 CTGCTGGGTCATGTGGCCCAAGG + Intergenic
983905507 4:173177229-173177251 ATGCTGATGCTGCTGGTCCAGGG + Intronic
985579388 5:688987-689009 CTGCTGGTGCCTCAGGGCCAGGG - Intronic
985594234 5:781046-781068 CTGCTGGTGCCTCAGGGCCAGGG - Intergenic
986125598 5:4880330-4880352 CTGCGGGTGGAGATGGCTCATGG + Intergenic
986290511 5:6395819-6395841 CTGCTGGTTCAGCTCCTCCATGG - Intergenic
986325126 5:6666989-6667011 CGGCCAGTGCCGCTGGCCCATGG + Intronic
986574593 5:9198857-9198879 CTGCCTCTGCACCTGGCCCAAGG - Intronic
986587180 5:9330539-9330561 CTGCTGATTTAGCTGGCTCAGGG - Intronic
986626155 5:9725417-9725439 CTGCTGGCCCTGCTGGCCCTGGG + Intergenic
986812235 5:11372804-11372826 ATGCTGGCGCTGCTGGTCCACGG + Intronic
990321985 5:54638923-54638945 CTGCTCTAGTAGCTGGCCCATGG - Intergenic
990417213 5:55597941-55597963 CAGATGGTGGGGCTGGCCCAAGG + Intergenic
991122844 5:63035315-63035337 CTGGAGGTACAGCTGACCCAGGG - Intergenic
992714627 5:79497863-79497885 ATGCTGATGCTGCTGGTCCAGGG - Intronic
992890037 5:81195636-81195658 ATGCTGATGCTGCTGGCCCGGGG - Intronic
992948455 5:81832842-81832864 ATGCTGATGCAGCGGGTCCAGGG + Intergenic
993881333 5:93365261-93365283 CTGCTGCTTCATCTGGCCCATGG + Intergenic
994046371 5:95314907-95314929 CTGCTGCTGCTGCTGGTCCAGGG + Intergenic
994069214 5:95579582-95579604 CTGCTGATGTTGCTGGTCCATGG + Intronic
995529123 5:113075135-113075157 CGGCTGGTGCCACTGGCCCTGGG + Intronic
996465639 5:123799434-123799456 ATGCTGATACTGCTGGCCCAGGG + Intergenic
996542123 5:124641319-124641341 GTGCAGGTGCCGCTGGCCGAAGG + Exonic
996577247 5:124988975-124988997 ATGCTGATGCTGCTGGCCCAGGG + Intergenic
996692257 5:126352763-126352785 CAGCAGGTACAGCTGGCACATGG - Intergenic
997158207 5:131580294-131580316 CGGCTGGTGCTGCCGGCCCTGGG - Intronic
998166335 5:139846546-139846568 CTGCTGGGGAACCTGGCCAAGGG - Intergenic
998799639 5:145856379-145856401 CTGCTCCTGCAGCTGCCCTATGG + Intergenic
998849520 5:146339879-146339901 GGCCTGGTGCAGGTGGCCCATGG - Exonic
999296306 5:150461560-150461582 CTGCTGGTGCAGCATCCCCGGGG + Intergenic
999626678 5:153528582-153528604 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1000931760 5:167261054-167261076 ATGCTGATGCAGCTGGTCCTGGG - Intergenic
1001005437 5:168045667-168045689 GTGCAGCTGCAGCTGGCCCAAGG + Intronic
1001173567 5:169444482-169444504 CTGCTGGGTCATATGGCCCAAGG - Intergenic
1001279603 5:170377349-170377371 ATCCTGATGCTGCTGGCCCAGGG + Exonic
1001700076 5:173700479-173700501 ATGCTGGTGCTGCTGGTCCCGGG + Intergenic
1001780475 5:174364625-174364647 ATGCTGATGCTGCTGGCCCAGGG - Intergenic
1001920577 5:175596556-175596578 CTGCTGCTGCAGCTGGTCTGGGG + Intergenic
1001945163 5:175772600-175772622 CTGCTGGCGGAGCTGGACCGTGG - Intergenic
1002261646 5:177997350-177997372 CTGCTGCTGCTGCTGATCCATGG - Intergenic
1002465443 5:179406045-179406067 CTGCTGCTGCTGCTGGACCTGGG + Intergenic
1002535744 5:179874461-179874483 CAGCTGTTCCAGCGGGCCCAGGG + Intronic
1002602248 5:180360714-180360736 CTGATGGGGCAGACGGCCCAAGG - Intergenic
1002647666 5:180669020-180669042 CGGCTGGAGCACCTGCCCCATGG + Intergenic
1003120590 6:3316123-3316145 ATGCTGATGCTGCTGGCCCAGGG + Intronic
1003328538 6:5110880-5110902 ATGCTGATGCTGCTGGTCCACGG + Intronic
1003444708 6:6173965-6173987 ATGCTGATGCAGCTGGCTCATGG + Intronic
1003633172 6:7807238-7807260 ATGCTGATGCTGCTGGTCCATGG - Intronic
1003645550 6:7910691-7910713 CTGCTGCTGCTGCTGGGCCATGG - Exonic
1003879915 6:10470779-10470801 CTGCTGCTGCAGCTGGTCTCAGG + Intergenic
1006904807 6:37526048-37526070 GTTCTGATGCTGCTGGCCCAGGG - Intergenic
1007340105 6:41185976-41185998 CTGCTGGTGCTCCTGGCCTCAGG - Intergenic
1007469914 6:42082850-42082872 GTGCGGGGGCAGCTGGCCCAGGG + Exonic
1007633220 6:43284041-43284063 CTGCTGTTGCGGCTGGCCTCAGG + Exonic
1007832821 6:44651861-44651883 CTGCTGCTGCCGCTGGTCCCGGG + Intergenic
1008469376 6:51866048-51866070 CTGCTGCTGCTGCTGGTCCATGG + Intronic
1008544223 6:52571638-52571660 CTGGTGGTGCAGCTGCTCCATGG - Intronic
1011714321 6:90088625-90088647 AGGCTGATGCAGCTGGTCCAGGG - Intronic
1011739996 6:90350000-90350022 ATGCTGCTGCTGCTGGTCCAGGG + Intergenic
1013309919 6:108884263-108884285 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1013765430 6:113568802-113568824 ATGCTGATGCTGCTGGCCCAGGG + Intergenic
1015394020 6:132715307-132715329 TAGCTGGTGCCTCTGGCCCAAGG + Intergenic
1016356377 6:143223188-143223210 ATGCTGATGCTGCTGGCACAGGG - Intronic
1016866306 6:148770795-148770817 CAGCTGGTGCAGCGGGCAGAGGG + Intronic
1017840911 6:158222303-158222325 CTGCTTCTGCTGCTGGGCCAGGG + Intergenic
1018472695 6:164110724-164110746 CTGCTGCTCCAGCTGTCACATGG - Intergenic
1018714755 6:166523410-166523432 GTGAGGATGCAGCTGGCCCAGGG + Intronic
1018909090 6:168091650-168091672 GTGCTGGTGCTGCCGGCCCAGGG + Intergenic
1019219896 6:170464864-170464886 CTGGTGGTGGAGGGGGCCCAAGG + Intergenic
1019523326 7:1470117-1470139 CTGCGGGAACTGCTGGCCCAAGG + Intergenic
1019750359 7:2725315-2725337 CGTCTGGTGCCGCGGGCCCAGGG - Intronic
1019750972 7:2729576-2729598 CTGCTTCTGCATCTGCCCCAAGG + Exonic
1020458435 7:8400804-8400826 CTTCTGGTACAGGTGACCCATGG - Intergenic
1021622143 7:22559570-22559592 ATGCTGTTGCTGCTGCCCCAGGG + Intronic
1021992685 7:26152758-26152780 CTCCCGGAGCAGCTGGCCCTCGG - Exonic
1022100299 7:27165335-27165357 CTGCCGGGGAGGCTGGCCCAGGG + Exonic
1022128499 7:27380468-27380490 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
1022503882 7:30898694-30898716 CAGCCAGTCCAGCTGGCCCAAGG - Intergenic
1022799402 7:33761400-33761422 ATGCTGATGCTGCTGGACCAGGG + Intergenic
1023044841 7:36201962-36201984 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1023185682 7:37530583-37530605 ATGCTGATGCTGCAGGCCCAAGG + Intergenic
1023760655 7:43462438-43462460 ATCCTGATGCTGCTGGCCCAGGG - Intronic
1024305946 7:47929683-47929705 ATGCTGATGCTGCTGGCCCTGGG - Intronic
1026059253 7:67011457-67011479 ATGCTGATGCTGCTGGCTCAGGG - Intronic
1026718842 7:72813590-72813612 ATGCTGATGCTGCTGGCTCAGGG + Intronic
1028231086 7:88307050-88307072 CTGATGGTGCCGCTGACCCCCGG + Intergenic
1028508794 7:91598995-91599017 CAGCTGGTGCAGAGGCCCCAAGG + Intergenic
1028727166 7:94100992-94101014 CAGCTGGTGCCGCTGGCCCTGGG + Intergenic
1028754519 7:94420255-94420277 CTGCTGGTCCTGCTGGTCCTCGG + Exonic
1028838493 7:95400335-95400357 ATGCTGATGCTGCTGGCCCAGGG + Intergenic
1029065356 7:97843126-97843148 CGGCTGGCGCCGCTGGCCCCGGG - Intergenic
1029331413 7:99859263-99859285 CTGCTGGTGCTGCTGGTCCATGG + Intronic
1029422273 7:100477800-100477822 CGGGTGGTGAAGCTGCCCCACGG - Exonic
1031133821 7:117863582-117863604 CTGCTGATGTTGCTGGTCCACGG + Intronic
1031698669 7:124894946-124894968 CTGCTGGTGCAAAAGGCACATGG + Intronic
1032848622 7:135773197-135773219 ATGCTGGTGCTGCTGGTTCAGGG - Intergenic
1033646408 7:143308175-143308197 GTGCAGGTGCAGATGGGCCATGG + Intergenic
1034094520 7:148394773-148394795 CTGCTGATGCAGCGGGTCCCTGG + Intronic
1034269540 7:149796959-149796981 CTGCCGATGCTGCTGGTCCAGGG - Intergenic
1034306537 7:150048619-150048641 CTGAAGGTGCAGCCGGCCCCGGG + Intergenic
1034424437 7:151007196-151007218 CGGCTGCTGCAGCTGGGCCAGGG + Exonic
1034480978 7:151320453-151320475 CTTGAGGTGGAGCTGGCCCAGGG + Intergenic
1034566970 7:151923133-151923155 CTGCTGGTGCCGCTGCCCTTTGG + Intergenic
1034800310 7:154052024-154052046 CTGAAGGTGCAGCCGGCCCCGGG - Intronic
1035686613 8:1528189-1528211 CTGCTGGAACAGCTGCCCCGAGG + Intronic
1035757122 8:2042940-2042962 CTGCAGGTGCACCTCACCCAGGG + Intergenic
1036694588 8:10966261-10966283 ATGCTGATGCCGCTGGTCCATGG + Intronic
1036768563 8:11564003-11564025 GTGCTGGCGCAGCCGGCCCGAGG + Exonic
1037973465 8:23191886-23191908 GAGCTGGTACAGCAGGCCCAGGG - Exonic
1039072926 8:33662488-33662510 ATGCTGATGTTGCTGGCCCAGGG + Intergenic
1039335148 8:36581030-36581052 ATGCTGATGCTGCTGGTCCATGG - Intergenic
1039593759 8:38771938-38771960 ATGCTGATGTTGCTGGCCCAGGG + Intronic
1039839072 8:41280700-41280722 CTGCAGGAGCTGCTGACCCATGG + Intronic
1040583424 8:48716238-48716260 CTGCGGGTGCCGCCGGCCCCAGG - Intronic
1040859476 8:51984252-51984274 AGGCAGGTGCAGCTGGCCCTGGG - Intergenic
1041384046 8:57279997-57280019 CTGCTGGGGCATCTGGCCAGGGG - Intergenic
1042404547 8:68388859-68388881 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1042804895 8:72760496-72760518 ATGCTGTTGCTGCTGGTCCAGGG - Intronic
1044721894 8:95159157-95159179 CTGTTAGTGCTGCTGGCCCAGGG + Intergenic
1045016959 8:98008653-98008675 CTGCTGCTGCAGCCAGCTCAGGG + Intronic
1045183434 8:99811533-99811555 CTGCTGATGCTGCTGGTCCAGGG + Intronic
1046019167 8:108643301-108643323 ATGCTGATGCTGCTGGTCCAAGG + Intronic
1046680711 8:117166589-117166611 ATGCTGGTGCTGCTGGTCCCAGG + Intronic
1046997991 8:120545416-120545438 GTTCTGATGCTGCTGGCCCATGG - Intronic
1047633724 8:126736191-126736213 CTGCTGATGTAGCTGCCACAGGG + Intergenic
1047692657 8:127372116-127372138 ATGTTGATGCTGCTGGCCCAGGG + Intergenic
1047963517 8:130028274-130028296 CTGTTGATGCTGCTGGTCCAAGG - Intergenic
1048186896 8:132249917-132249939 CGGCCGGTGCCGCTGGCCCCAGG - Intronic
1049095735 8:140547137-140547159 CTGCTGCTGCTGCTGAGCCAGGG + Intronic
1049432634 8:142572318-142572340 CAGCTGGTGGAGCTGAGCCAGGG - Intergenic
1049670830 8:143869166-143869188 CTGCAGGTGCAGCTGGCCACAGG - Exonic
1049713328 8:144077418-144077440 CTGCTGCTGCAGCTGGTCTGAGG - Intergenic
1049772934 8:144392124-144392146 GAGCTGGTGCTGCTGGACCACGG + Exonic
1049787829 8:144459551-144459573 CTGCAGGGCCAGCTGACCCATGG - Intronic
1049923770 9:389585-389607 CTGCTGCTGCTGCTGGTCCAGGG - Intronic
1050247264 9:3703730-3703752 GTGCTGATGCTGCTGGTCCAGGG - Intergenic
1051125578 9:13800864-13800886 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1051619153 9:19033870-19033892 ATGCTGGTTCTGCTGGGCCACGG + Intronic
1052996218 9:34552838-34552860 CTGCAGGTGGAGCTGTCCGACGG - Exonic
1053575705 9:39356253-39356275 TTTCTGGTGCAGGTGGCTCAGGG + Intronic
1054097275 9:60914958-60914980 TTTCTGGTGCAGGTGGCTCAGGG + Intergenic
1054118681 9:61190587-61190609 TTTCTGGTGCAGGTGGCTCAGGG + Intronic
1054456977 9:65437012-65437034 CTGTTTGTGAAGCTCGCCCAGGG - Intergenic
1054589076 9:66991977-66991999 TTTCTGGTGCAGGTGGCTCAGGG - Intergenic
1054828711 9:69599655-69599677 CTGCTGGTGCTACTGGTCCAGGG - Intronic
1055223465 9:73966245-73966267 CTGCTGGATCATATGGCCCAAGG - Intergenic
1055279731 9:74660668-74660690 CAGCTGGTGCAGCTCTTCCATGG - Exonic
1055296317 9:74837350-74837372 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1055715531 9:79113588-79113610 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1057004959 9:91548978-91549000 CTGCTGGGTCATATGGCCCAAGG + Intergenic
1057075912 9:92138067-92138089 CTGCTGCAGCAGCTGCTCCATGG - Intergenic
1057396154 9:94682357-94682379 ATGCTGATGCTGCTGGTCCATGG + Intergenic
1057492189 9:95529053-95529075 CTGCTGCTGCTGCTGCTCCAGGG - Intergenic
1057502601 9:95607544-95607566 GTGATGGTGCTGCTGGCCCCCGG + Intergenic
1057846887 9:98532739-98532761 CTGCTGATGATGCTGGTCCAGGG + Intronic
1057897697 9:98922965-98922987 CTGCTCCTGCTGCTGGTCCAGGG + Intergenic
1057902007 9:98956748-98956770 ATGCTGATGCTGCTGGTCCATGG - Intronic
1057968310 9:99526489-99526511 GTGCTACTGCAGCTGGCACATGG - Intergenic
1058174506 9:101722125-101722147 CAGCTGGAGCAGCTGGGACACGG - Intronic
1058623658 9:106911572-106911594 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1058759720 9:108119265-108119287 CTCCTGGGGCAGGTGACCCATGG + Intergenic
1058836576 9:108862965-108862987 CTGGTGGTGGAGGTGGGCCATGG + Exonic
1058981674 9:110176180-110176202 ATGCTGCTGCTGCTGGTCCAGGG + Intergenic
1059210579 9:112511194-112511216 ATACTGGTGCTGCTGGTCCAAGG - Intronic
1059277508 9:113108765-113108787 CTCCTGGGGCTGCTGGCCCCGGG - Intergenic
1059278743 9:113115786-113115808 CTCCTGGGGCTGCTGGCCCCGGG + Intergenic
1060149276 9:121277405-121277427 ATGCTGATGTAGCTGGTCCAGGG + Intronic
1060299739 9:122368235-122368257 CAGCTGGGGGTGCTGGCCCATGG + Intergenic
1060521416 9:124296165-124296187 CTGTTGGTCCAGCTGGCTCCTGG - Intronic
1060940404 9:127540123-127540145 CTGCTGTTGGAGCTGGTCCCAGG - Intronic
1061049544 9:128186290-128186312 GTGGAGGTGCAGCTTGCCCAGGG + Intronic
1061392807 9:130327221-130327243 CTCCTGGGGGAGCTGCCCCATGG + Intronic
1061957619 9:133971762-133971784 CGGGTGGTGCAGGTGGCCCCAGG - Intronic
1062257991 9:135639390-135639412 GTGCACGTGCAGCTGACCCACGG - Exonic
1062395333 9:136350476-136350498 CTGCAGCTCCAGCTGGGCCAAGG + Intronic
1062501473 9:136853788-136853810 CTGCGGGTGGAGCTGACCCATGG + Exonic
1062537696 9:137028120-137028142 CAGCTGGTGCAGGAAGCCCATGG + Exonic
1062617310 9:137403652-137403674 CTGCTGGTCCATCTCCCCCAAGG - Intronic
1062697167 9:137881321-137881343 CCTGTGGTGGAGCTGGCCCAAGG - Intronic
1186537702 X:10366926-10366948 CTGCTGGTGCTGCTGGTCCAAGG + Intergenic
1186610004 X:11129784-11129806 ATGCTGATGCTGCTGGGCCAGGG + Intergenic
1186763523 X:12747684-12747706 AGGCTGATGCTGCTGGCCCAGGG + Intergenic
1186996404 X:15128225-15128247 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1187244662 X:17543166-17543188 CTACTGGTGATGTTGGCCCACGG + Intronic
1187274850 X:17808224-17808246 CTGCTGCTGCTGCTGCTCCAAGG - Intronic
1187420685 X:19131074-19131096 ATGCTGATGCTGCTGGTCCATGG + Intergenic
1187682151 X:21778391-21778413 CAGCTGCTGCAGCTTCCCCAAGG + Intergenic
1187940703 X:24378069-24378091 CTGCTGCTGCTGCTGGATCAGGG + Intergenic
1188350678 X:29127376-29127398 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1188437116 X:30173686-30173708 CTGCTGCTGCTGCTGGCCTGGGG - Intergenic
1188538722 X:31225753-31225775 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1188574513 X:31631053-31631075 TTGCTGGTGCTGCTGGTCCATGG - Intronic
1188871958 X:35383187-35383209 CGGCTGCTGCAGCTGGATCAGGG - Intergenic
1189124036 X:38426443-38426465 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1189124204 X:38428703-38428725 CTGCTGATGCTGCTGTTCCAGGG + Intronic
1189166562 X:38866675-38866697 ATGCTGATGCTGCTGGTCCATGG - Intergenic
1189862892 X:45291592-45291614 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1189871109 X:45383792-45383814 ATGCTGATGCTGCTGGTCCATGG - Intergenic
1190021952 X:46886624-46886646 ATACTGATGCTGCTGGCCCATGG - Intergenic
1190455766 X:50626517-50626539 ATGCTGATGCAGCTGGTCCTGGG - Intronic
1190827605 X:54031957-54031979 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1192496046 X:71617257-71617279 CTGCTGGGGCTGCTGGGCAACGG - Exonic
1194403621 X:93467836-93467858 GGGCTGTGGCAGCTGGCCCAGGG - Intergenic
1194997730 X:100610258-100610280 ATTCTGGTGCAAGTGGCCCAAGG + Intergenic
1195712727 X:107787172-107787194 GTGCTGCTCCTGCTGGCCCACGG + Intronic
1195865848 X:109432043-109432065 ATGCTGATGCAGCTGGTCCAGGG - Intronic
1195965595 X:110427349-110427371 ATGCTGGTGTTGCTGGCCCCAGG - Intronic
1195981240 X:110580757-110580779 ATGCTGGTGCTGCTGGTCCATGG + Intergenic
1196117580 X:112014136-112014158 CTGCTGGTGCTGCTGGTCCAGGG + Intronic
1198243042 X:134803050-134803072 TTGCAGGTGCAGCTGGCCAGTGG + Intronic