ID: 926002954

View in Genome Browser
Species Human (GRCh38)
Location 2:9348895-9348917
Sequence ACGTGGGTATCCATGGAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926002954_926002964 -5 Left 926002954 2:9348895-9348917 CCGCCTTCCATGGATACCCACGT 0: 1
1: 0
2: 0
3: 8
4: 105
Right 926002964 2:9348913-9348935 CACGTCGAGGACAGGGAGGGTGG 0: 1
1: 0
2: 0
3: 14
4: 189
926002954_926002961 -8 Left 926002954 2:9348895-9348917 CCGCCTTCCATGGATACCCACGT 0: 1
1: 0
2: 0
3: 8
4: 105
Right 926002961 2:9348910-9348932 ACCCACGTCGAGGACAGGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 114
926002954_926002965 16 Left 926002954 2:9348895-9348917 CCGCCTTCCATGGATACCCACGT 0: 1
1: 0
2: 0
3: 8
4: 105
Right 926002965 2:9348934-9348956 GGCAGTTGAGCCCCGAGCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 219
926002954_926002960 -9 Left 926002954 2:9348895-9348917 CCGCCTTCCATGGATACCCACGT 0: 1
1: 0
2: 0
3: 8
4: 105
Right 926002960 2:9348909-9348931 TACCCACGTCGAGGACAGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926002954 Original CRISPR ACGTGGGTATCCATGGAAGG CGG (reversed) Intronic
900437078 1:2635839-2635861 CCCTGGGTATCCAGGGCAGGAGG + Intergenic
901458402 1:9376985-9377007 AAGCGGGTAACCAGGGAAGGGGG + Intergenic
902247549 1:15130984-15131006 ACGTGGGTAAGCCTGGAAGCAGG + Intergenic
903184046 1:21619543-21619565 ACATAGGTATGCATGGGAGGTGG - Intronic
903861104 1:26364952-26364974 AAGTGGGTATCCAGGGTAGAAGG + Exonic
904982842 1:34521412-34521434 ACGTGGGTATCCTTGGTGGTGGG + Intergenic
906247073 1:44283886-44283908 ACCTGGGCATTCAAGGAAGGTGG - Intronic
910652930 1:89589364-89589386 ATGTGGGTGGACATGGAAGGTGG + Intronic
914345174 1:146793008-146793030 ACCTGGGTTTGCATGGAAGATGG - Intergenic
915347613 1:155205939-155205961 ACTTGGGGATGCCTGGAAGGAGG - Intronic
924093507 1:240526185-240526207 ACGTGGGCATCTTTGGAGGGGGG + Intronic
1065944803 10:30596594-30596616 CCGTGGGTATACATGGAATGTGG - Intergenic
1068078239 10:52285129-52285151 TGGTGTGTATGCATGGAAGGGGG - Intronic
1073317585 10:102593720-102593742 ATGTGAGTACCCATGCAAGGTGG + Exonic
1074364847 10:112849563-112849585 GCCTGGGTATCCATTGGAGGGGG + Intergenic
1078660675 11:13282982-13283004 ACTTAGGTCTGCATGGAAGGAGG + Intronic
1080435897 11:32243970-32243992 ACGTGTGTTTACATGGGAGGTGG + Intergenic
1080849098 11:36052473-36052495 CAGTGGGTATCTCTGGAAGGTGG + Intronic
1081366669 11:42243529-42243551 ACTGGGGTGTCCATGTAAGGTGG - Intergenic
1089037269 11:115407759-115407781 ACTTGGGAAGCCAAGGAAGGAGG + Intronic
1091379217 12:45159-45181 CCGTGGGGATTCATGGATGGAGG + Intergenic
1094438928 12:30453378-30453400 ACATGGGAATTCATTGAAGGAGG + Intergenic
1098425203 12:70356340-70356362 ACGTGGTTATACATGTAAAGAGG + Intergenic
1099091648 12:78317946-78317968 GCGGGGGTATGCATGGAATGGGG - Intergenic
1100280002 12:93109300-93109322 ACGTTGGTATACATGGAACATGG - Intergenic
1107590591 13:41899862-41899884 AAGTGGGTATTGATGTAAGGAGG - Intronic
1109932074 13:69228990-69229012 ACCTAGGTATCCATTGATGGTGG - Intergenic
1110768357 13:79306114-79306136 CCGTCGGTAACCCTGGAAGGTGG - Intergenic
1115503057 14:34066132-34066154 GCTAGGGTAGCCATGGAAGGAGG - Intronic
1122994602 14:105256296-105256318 GTGTGGGTCTCCATGGCAGGAGG - Intronic
1124130307 15:26978535-26978557 AATTGGGCATCCATGGAGGGTGG - Intronic
1125476605 15:40051977-40051999 ACGTGGGGATTCCTGGAGGGTGG + Intergenic
1126442066 15:48700058-48700080 ACTTGGGTAACCAAGGCAGGAGG + Intergenic
1129718401 15:77864901-77864923 AGGTGGGGCTCCATGGAGGGAGG - Intergenic
1132068945 15:98758567-98758589 AGGGGGGCTTCCATGGAAGGTGG - Intronic
1138543325 16:57701600-57701622 AGGTGGGTATCGAAGGAAGGGGG + Intronic
1139474820 16:67197910-67197932 AGGTGGGTGGCCCTGGAAGGTGG + Exonic
1141786584 16:86204827-86204849 AGGAGAGTATCCTTGGAAGGGGG + Intergenic
1146128460 17:30248975-30248997 ACGTCAGGTTCCATGGAAGGAGG + Exonic
1148450793 17:47776857-47776879 ACTTGGGTATCTATCGAAGCAGG + Intergenic
1150430995 17:65117232-65117254 ACGTGGGTATGGATGGCACGTGG - Intergenic
1155332197 18:24729775-24729797 ACCTGGGTATAATTGGAAGGTGG - Intergenic
1156396399 18:36703883-36703905 ACATGAGAACCCATGGAAGGGGG - Intronic
1156610897 18:38722914-38722936 ATGAGGTTATCAATGGAAGGGGG + Intergenic
1161013420 19:1970868-1970890 ACGTGGGCACCCATGGCAGGCGG + Intronic
1161233509 19:3187053-3187075 GCGTGGGTATGCATCAAAGGCGG - Intronic
1163135167 19:15305284-15305306 ACTTGGGTAGCCAAGGCAGGTGG - Intronic
1167144571 19:47673930-47673952 AAGGAGGTGTCCATGGAAGGAGG - Intronic
1167193750 19:48012014-48012036 ACGTGGGTTTTCATGTAATGAGG + Intronic
926002954 2:9348895-9348917 ACGTGGGTATCCATGGAAGGCGG - Intronic
926670235 2:15570210-15570232 GTGTGGGAATCCATGGAAGACGG - Intergenic
927732141 2:25483039-25483061 AGGTGGGGACCCATGGAGGGGGG + Intronic
927847838 2:26480469-26480491 GCCTGGATATCCATGGAAGCAGG + Intronic
930696528 2:54417126-54417148 AAGTGGGGATCCAAGGAGGGAGG + Intergenic
936681737 2:114781387-114781409 AAGTGGTTATCCATGGATGGTGG + Intronic
937095587 2:119233227-119233249 ATGGGGGTACTCATGGAAGGAGG - Intronic
937978064 2:127593510-127593532 ACGGGGGTATCGGTGGGAGGTGG - Intronic
945208598 2:207358762-207358784 ACGTGGGCATCCATGGATTTTGG + Intergenic
945486171 2:210398677-210398699 ATGTAGGTATGCATAGAAGGTGG - Intergenic
947152124 2:227126248-227126270 ACGTGAGTATCCATGGATTTTGG + Intronic
1169423916 20:5481617-5481639 AGGTGGGTATCCATGGGTTGCGG + Intergenic
1172994561 20:39060467-39060489 ACCTGGGTATCCATCAATGGGGG + Intergenic
1173123010 20:40311057-40311079 ACGTAGGTGTGTATGGAAGGTGG + Intergenic
1173515377 20:43661977-43661999 ATGTGGATCTCAATGGAAGGAGG - Intergenic
1174049863 20:47760119-47760141 TCGTTGGTGTCCATGGAGGGTGG - Intronic
1175219798 20:57410209-57410231 ACTTGGGGATCCACGGAGGGGGG + Intergenic
1176965497 21:15207935-15207957 ATGTGGGAATCCATGGACTGTGG - Intergenic
1181954804 22:26580403-26580425 CCCTGGGTATCCAGGGAAGAAGG + Intronic
1182471297 22:30549909-30549931 AGGTGGGGATCCAGGCAAGGTGG + Intergenic
949650603 3:6154741-6154763 GTTTGGGTATCCAGGGAAGGTGG - Intergenic
952024067 3:29057614-29057636 ACAAAGGTATCCAGGGAAGGTGG - Intergenic
967305879 3:188058929-188058951 GCGTGGTTATCCATCTAAGGTGG - Intergenic
968243848 3:197120956-197120978 ACGTGGGTATCTATTGATTGAGG - Intronic
970259257 4:14206983-14207005 ACGTGGTCATCCATGGAAGAGGG - Intergenic
977503613 4:97874516-97874538 ACGTGGATGTCTATGGAAGGTGG - Intronic
977697408 4:99981844-99981866 AGGAGGGTATCCATGCATGGGGG - Intergenic
981032592 4:140140470-140140492 ACCTGGCTATCTATGGAATGAGG + Intronic
982477704 4:155873313-155873335 ACTTGGGGATACAAGGAAGGAGG - Intronic
984679727 4:182593583-182593605 ACATGGAGATCCAGGGAAGGAGG + Intronic
988501111 5:31784547-31784569 AAGTGGGTATGAATAGAAGGGGG + Intronic
992078839 5:73215890-73215912 ACGTGGTTATGCACGGACGGAGG - Intergenic
995853601 5:116572513-116572535 GCGTGGCTATCCAGGGAGGGAGG - Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
1007554591 6:42755347-42755369 GCTGGGGTATCCCTGGAAGGTGG + Intronic
1007790653 6:44306416-44306438 AGCTGGGTCTCCTTGGAAGGAGG + Intronic
1013399147 6:109774187-109774209 AAGTGGCTATCTCTGGAAGGTGG - Intronic
1017034716 6:150256929-150256951 AAGTGGGTATCCAAGGGAGATGG - Intergenic
1019079542 6:169420879-169420901 AGATGGGTACCCATGGCAGGAGG - Intergenic
1019578275 7:1748100-1748122 ACGTGGGAACCCTTGGGAGGTGG + Intergenic
1021093730 7:16511697-16511719 AGGAGGGTATCCATGGAAAGGGG + Intronic
1022589624 7:31649352-31649374 AAGTTGGTCTCCATGGAAGGAGG + Intronic
1023115548 7:36858488-36858510 ATGTGGGTGTCTTTGGAAGGCGG - Intronic
1024791316 7:52967832-52967854 ATGTGGGGATACAGGGAAGGGGG - Intergenic
1026589295 7:71681518-71681540 CTGTGGGTATCCTAGGAAGGTGG - Intronic
1027575361 7:79923624-79923646 ATGTGAGTATTCATGGAAGAAGG - Intergenic
1029036677 7:97529562-97529584 ACGTGGAGATTCATGGAGGGTGG - Intergenic
1032874853 7:136027222-136027244 ATTTGGGAACCCATGGAAGGGGG + Intergenic
1037607910 8:20452927-20452949 ATGTGGCTGTCCATGGGAGGTGG + Intergenic
1037844621 8:22272264-22272286 ATTTTGGTATCCATGGAGGGAGG + Intergenic
1041950472 8:63495464-63495486 ACATGGGGATTCCTGGAAGGTGG + Intergenic
1044739930 8:95315719-95315741 ACTTGGGGATCCTTGGAAGAAGG - Intergenic
1044763746 8:95549633-95549655 CCCTGGGTATCCATGGGAAGAGG + Intergenic
1044790815 8:95844998-95845020 AAATGGGTACCCTTGGAAGGTGG - Intergenic
1045297766 8:100887186-100887208 ACATGGGGAACAATGGAAGGAGG - Intergenic
1046275220 8:111950153-111950175 CCGTGGGAATCAGTGGAAGGAGG + Intergenic
1047984341 8:130217003-130217025 ACTTGGATATCCATGGCAAGTGG - Intronic
1051679361 9:19591604-19591626 ACGTCTGTATTCTTGGAAGGAGG - Intronic
1054843849 9:69771624-69771646 ACTTGGGAAGCCAAGGAAGGTGG - Intergenic
1061805647 9:133136312-133136334 GCGCGGGTATGGATGGAAGGAGG + Intronic
1062237941 9:135521662-135521684 ACGAGGGTCTCCTTGGATGGAGG - Intronic
1186750667 X:12618810-12618832 ACGTGGGTTTCTCTGGATGGAGG - Intronic
1186940269 X:14499455-14499477 ACCTAGGTATCCATCGATGGTGG + Intergenic
1189248039 X:39578648-39578670 AATTGGGCACCCATGGAAGGGGG - Intergenic
1193307522 X:79966859-79966881 ACGTGCCTATCAATGGATGGGGG - Intergenic