ID: 926003256

View in Genome Browser
Species Human (GRCh38)
Location 2:9351508-9351530
Sequence CCTGCCACACAGAACTACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 198}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926003256_926003260 -9 Left 926003256 2:9351508-9351530 CCTAGGTAGTTCTGTGTGGCAGG 0: 1
1: 0
2: 0
3: 18
4: 198
Right 926003260 2:9351522-9351544 TGTGGCAGGGTTAGAGTCTAGGG 0: 1
1: 0
2: 1
3: 9
4: 141
926003256_926003261 -8 Left 926003256 2:9351508-9351530 CCTAGGTAGTTCTGTGTGGCAGG 0: 1
1: 0
2: 0
3: 18
4: 198
Right 926003261 2:9351523-9351545 GTGGCAGGGTTAGAGTCTAGGGG 0: 1
1: 0
2: 1
3: 14
4: 140
926003256_926003262 0 Left 926003256 2:9351508-9351530 CCTAGGTAGTTCTGTGTGGCAGG 0: 1
1: 0
2: 0
3: 18
4: 198
Right 926003262 2:9351531-9351553 GTTAGAGTCTAGGGGAAGAAAGG 0: 1
1: 0
2: 2
3: 18
4: 187
926003256_926003264 22 Left 926003256 2:9351508-9351530 CCTAGGTAGTTCTGTGTGGCAGG 0: 1
1: 0
2: 0
3: 18
4: 198
Right 926003264 2:9351553-9351575 GGCCAGTCTCCCCTTTGAAGAGG 0: 1
1: 0
2: 0
3: 9
4: 128
926003256_926003259 -10 Left 926003256 2:9351508-9351530 CCTAGGTAGTTCTGTGTGGCAGG 0: 1
1: 0
2: 0
3: 18
4: 198
Right 926003259 2:9351521-9351543 GTGTGGCAGGGTTAGAGTCTAGG 0: 1
1: 0
2: 2
3: 25
4: 186
926003256_926003263 1 Left 926003256 2:9351508-9351530 CCTAGGTAGTTCTGTGTGGCAGG 0: 1
1: 0
2: 0
3: 18
4: 198
Right 926003263 2:9351532-9351554 TTAGAGTCTAGGGGAAGAAAGGG 0: 1
1: 0
2: 5
3: 20
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926003256 Original CRISPR CCTGCCACACAGAACTACCT AGG (reversed) Intronic
900313595 1:2046540-2046562 GCAGCCACACAGAGCCACCTTGG + Intergenic
900549419 1:3246630-3246652 GCTGCCACACAGCACTGCCTGGG + Intronic
900671532 1:3857649-3857671 CCAGCCACGCCGAACTTCCTCGG - Exonic
900952180 1:5864320-5864342 CCTGCCACACATACAGACCTTGG + Exonic
901750067 1:11400863-11400885 CCTGCTACACACAACAACGTGGG - Intergenic
901879666 1:12186310-12186332 CCTTCCTCACAGCACTGCCTGGG - Intronic
902295352 1:15463260-15463282 CCTGCCAGTCAGAGCAACCTGGG + Intronic
902526282 1:17059847-17059869 GCTGCCTCACAGAACTACCCAGG + Intergenic
902536262 1:17120649-17120671 CCTGCCACTCAGAAGCAGCTGGG - Intergenic
906315256 1:44782920-44782942 TCTGCCACAGAGCACTACATTGG - Intergenic
906645171 1:47469649-47469671 CCTGGCACACAGAGCTTACTGGG + Intergenic
908636678 1:66174455-66174477 ACTGCTATAAAGAACTACCTTGG + Intronic
908700737 1:66897612-66897634 CCCACTACCCAGAACTACCTTGG + Intronic
908710069 1:67005200-67005222 ACTGCCACCCAGGACTCCCTTGG + Intronic
909669042 1:78167600-78167622 CCTGTCACACAGAACAAGTTTGG + Intergenic
910192994 1:84613353-84613375 TCTGCCAAACAGATCTACTTTGG + Intergenic
911099804 1:94086508-94086530 CATGTGACTCAGAACTACCTAGG - Intronic
911750434 1:101490577-101490599 CCACCCACACACAAATACCTAGG - Intergenic
913547657 1:119885501-119885523 ACTGCCTCACACAAATACCTTGG + Intergenic
915465681 1:156096716-156096738 CCTGCCACTCAGGACTAGCCTGG + Intronic
915993554 1:160541687-160541709 CCAGCCACACAGAATTATCATGG - Intronic
918419149 1:184344684-184344706 CTTGCCTCACAGAACGATCTGGG + Intergenic
921917935 1:220633668-220633690 CATGTCACACAGACCTGCCTTGG - Intronic
1062990468 10:1809912-1809934 GCTGGGACACAGATCTACCTTGG - Intergenic
1064291039 10:14034269-14034291 CCTGCCACAGACAACCAGCTGGG - Intronic
1064300629 10:14119726-14119748 CCTGCCCCACAGACCTTCCAAGG + Intronic
1065839153 10:29686261-29686283 GCTGTCACACAGAACAAGCTGGG + Intronic
1068160532 10:53256887-53256909 CCTACAACAAAGAATTACCTAGG - Intergenic
1070382353 10:75892350-75892372 CCTGCCACCCAGAGCTCCCTGGG - Intronic
1070442149 10:76456879-76456901 CCTGCAACACAGAACTTGTTTGG + Intronic
1070795375 10:79213262-79213284 CTTGCCTCACAGAACTTTCTGGG + Intronic
1072755272 10:98016581-98016603 GCTGCCCAACAGAACCACCTCGG + Intronic
1074790658 10:116883796-116883818 CCTGCCAGTCAGAACTTCCATGG + Exonic
1075135924 10:119786289-119786311 CATACCACACAGAACTGGCTGGG + Intronic
1079130603 11:17744823-17744845 CCTGACCCTCAGAATTACCTGGG + Intronic
1079639008 11:22780767-22780789 CCTGAGACACAGAACCACCTTGG - Intronic
1081084165 11:38778476-38778498 CATGCCTCTGAGAACTACCTGGG + Intergenic
1084177778 11:67432471-67432493 CCTGCCTCACAGAGCTGCCGTGG - Intronic
1084515616 11:69636806-69636828 CCTGCCGCCCAGAACTCGCTGGG + Intergenic
1084797792 11:71519572-71519594 CCTGTCACACAGGATTCCCTGGG + Intronic
1085408230 11:76276788-76276810 CCTGGCACACAGGACCAACTGGG - Intergenic
1088025528 11:105177376-105177398 ACTGCAATAAAGAACTACCTGGG + Intergenic
1090306241 11:125693553-125693575 CCTGCCAAACAGACATACCTGGG + Intergenic
1090386437 11:126359988-126360010 CCTGCCAGGCAGAAGCACCTTGG + Intronic
1090803607 11:130189367-130189389 CCTGCCACACAGCATTCCCCAGG - Intronic
1094738135 12:33258837-33258859 TCTGCCATAAAGAACTGCCTGGG - Intergenic
1108076184 13:46682066-46682088 CGTGCCCCACAGCATTACCTAGG - Intronic
1111323563 13:86662881-86662903 ACTCCTACAAAGAACTACCTGGG + Intergenic
1113351341 13:109532425-109532447 ACTGCTATAAAGAACTACCTGGG + Intergenic
1113661477 13:112108955-112108977 CCTGCCACCAAGAGCCACCTTGG - Intergenic
1113802213 13:113092532-113092554 CAGGCCACCCAGAACCACCTGGG - Intronic
1113877661 13:113604718-113604740 CCTATGACACAGAACTACCAGGG - Intronic
1114244398 14:20899383-20899405 ACTGCTATAAAGAACTACCTAGG + Intergenic
1118753563 14:68822912-68822934 GCTGTCACAGAGAACTTCCTTGG + Intergenic
1118851493 14:69587179-69587201 CCTGCCACAAAGTTCTACCTGGG + Intergenic
1122429696 14:101632528-101632550 CCTGTCACACAGCACATCCTGGG - Intergenic
1122488276 14:102095992-102096014 CCTGCAACACACACCTTCCTTGG + Intronic
1122930687 14:104931883-104931905 CCTCCCACTCAGACCTACCTCGG - Exonic
1123972993 15:25526531-25526553 CCTACCACACAGCAATACCTGGG + Intergenic
1123989033 15:25669565-25669587 GCTGCCACACAGAGAAACCTTGG + Intergenic
1124160152 15:27260802-27260824 CCTGCCACCCAGCAACACCTGGG - Intronic
1125311595 15:38385132-38385154 CTGGCCACCCAGAACTCCCTGGG + Intergenic
1134016092 16:10889458-10889480 CACCCCACACAGAACTCCCTTGG + Intronic
1134595909 16:15495821-15495843 CCTCCCTCCCAGAACTCCCTTGG - Intronic
1134913009 16:18045455-18045477 ACAGCCACACAGATCAACCTAGG - Intergenic
1135503015 16:23013498-23013520 CCTTCCACACAAGACAACCTGGG + Intergenic
1135695038 16:24578167-24578189 CTTGGCACACAGAAACACCTAGG - Intergenic
1136748653 16:32614137-32614159 CCTGACACAGAGAACAAGCTGGG - Intergenic
1137833165 16:51563715-51563737 CCTGCAACAAAGAATTACCTAGG - Intergenic
1140946052 16:79769522-79769544 CCTGCAACACACATCCACCTCGG - Intergenic
1141145039 16:81523409-81523431 CCTGTCACACAGAAGGACGTGGG + Intronic
1141469840 16:84230798-84230820 CCTGCCCCACAGCATTGCCTGGG - Intronic
1141549476 16:84795780-84795802 TCTGCCACACAGGGCTACCCCGG + Intergenic
1141938911 16:87261343-87261365 CCTGGCACACAGATTTAGCTTGG - Intronic
1141940832 16:87274953-87274975 CCTCCCTCCCAGAAATACCTCGG + Intronic
1203050786 16_KI270728v1_random:873351-873373 CCTGACACAGAGAACAAGCTGGG - Intergenic
1142863966 17:2779332-2779354 CTGGCCACACAGAAATACCCCGG - Intronic
1144745671 17:17612547-17612569 CCTGCCACACAGTAGTCACTTGG - Intergenic
1148038379 17:44686339-44686361 CTAGACACACAGAACTTCCTTGG + Intronic
1149457597 17:56800777-56800799 ACTGCCACACAGAATGACCAGGG - Intronic
1150656882 17:67045092-67045114 CCAGCCAGACAGAAATAGCTGGG - Intronic
1151404823 17:73879455-73879477 CCTGCCACAAATTAATACCTGGG + Intergenic
1155374098 18:25137324-25137346 CCTGCCCCACAGTATCACCTCGG + Intronic
1157568022 18:48693205-48693227 CCTGCCACACAGGACAGCCTGGG - Intronic
1158619116 18:59015642-59015664 CATGCCACACAGAGCCACCTGGG + Intergenic
1159058276 18:63488681-63488703 CTTGACAATCAGAACTACCTGGG - Intronic
1159892152 18:73963323-73963345 ACTGCTATAGAGAACTACCTGGG + Intergenic
1160923481 19:1531734-1531756 CCAGCCACACAGGACCCCCTGGG + Exonic
1161216737 19:3098463-3098485 CCTGCCACAAAGAACTATACGGG - Intronic
1161535967 19:4818605-4818627 CCTGCCACCCAGACCTAGCCAGG + Intronic
1163387876 19:17011298-17011320 TCTGTCACAAAGAACTCCCTGGG + Intronic
1163659405 19:18567835-18567857 CCTGGCTCACTGCACTACCTGGG - Intronic
1164913921 19:32034654-32034676 CCTACCACACTGAATGACCTTGG - Intergenic
1166222990 19:41377434-41377456 CCTGCCACACAGCCCCATCTAGG - Intronic
1167614258 19:50523229-50523251 CCTGGCACACACCACTATCTGGG - Intronic
1168684559 19:58340369-58340391 CCAGCCACACGGAACTACTGTGG + Exonic
924960168 2:27534-27556 GGTGCCACACAGCACTCCCTTGG + Intergenic
925670243 2:6303281-6303303 CCTGCCACACAGAGCTTCCATGG - Intergenic
926003256 2:9351508-9351530 CCTGCCACACAGAACTACCTAGG - Intronic
929275577 2:40021443-40021465 CCTGCCACAAACTTCTACCTGGG - Intergenic
931607544 2:64067121-64067143 CCTGCCAGACAGACATACCAAGG + Intergenic
932400808 2:71479818-71479840 CCAGCCACATAGAGCTTCCTTGG + Intronic
934519794 2:95012927-95012949 CCTGCCACTCAGAAGTAGCCTGG - Intergenic
934963772 2:98701915-98701937 GCTGCCAATCAGAATTACCTAGG + Intronic
936152621 2:110030027-110030049 CCTGCCAGACAGAAGTAGCCGGG + Intergenic
936192059 2:110341385-110341407 CCTGCCAGACAGAAGTAGCCGGG - Intergenic
936500537 2:113062683-113062705 CGTGCCCCCCAGAACTCCCTGGG + Exonic
936986135 2:118312664-118312686 CCTGCCACACGGAGCTACCGAGG + Intergenic
937107872 2:119335547-119335569 TCTGCCACACAGAACTCCAAAGG + Intronic
937751049 2:125476701-125476723 CCTGCAACAAACATCTACCTGGG - Intergenic
939289822 2:140179831-140179853 CTTACCAGACAGAAGTACCTTGG - Intergenic
939551394 2:143619932-143619954 ATTGCTACAAAGAACTACCTGGG - Intronic
940958919 2:159760512-159760534 CCAGCTACAGAGAACTCCCTGGG - Intronic
948301870 2:236913822-236913844 CCTGCCACAGAGACCCACCCTGG - Intergenic
948666485 2:239537853-239537875 TCTGGCACACAGAACACCCTCGG - Intergenic
1169311534 20:4546196-4546218 CATGCCACAGAGAAATACATGGG + Intergenic
1173974260 20:47175183-47175205 CCTGCATCACAGAACTAGCCAGG + Intronic
1174252989 20:49233411-49233433 CCCGCCACAGAGAAGTCCCTCGG - Intronic
1174504187 20:51006012-51006034 CCTCCCATACAGAACCTCCTTGG + Intronic
1175257670 20:57656914-57656936 CCTGCCAGACAGGAGTCCCTGGG - Intronic
1175802356 20:61808078-61808100 CCTGCCACACAGAAGCAGCATGG + Intronic
1180262166 21:46679402-46679424 GGTGCCACACAGCACTCCCTTGG - Intergenic
1181680751 22:24494693-24494715 CCTCCCTCACAGGACTACCGAGG - Intronic
1183122374 22:35739910-35739932 CCTGCCAACCAGCACTACCATGG + Intronic
1183347949 22:37318317-37318339 CCTGGCACACAGAGCTGCCAGGG + Intergenic
950073185 3:10168786-10168808 CCAGCCACACTGACCTCCCTGGG + Intronic
953624670 3:44561107-44561129 ACTGCTATAAAGAACTACCTGGG + Intronic
953672570 3:44975613-44975635 CTTCCCACCAAGAACTACCTAGG + Intronic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
955286449 3:57646079-57646101 CCTGCCACTCAGAACAACAAAGG + Intronic
955697625 3:61652702-61652724 CCAGCAACACAGAACTATCGGGG - Intronic
956598575 3:70994735-70994757 CCTGCCAGGCAGATCAACCTTGG + Intronic
956710596 3:72035429-72035451 TCTGCCACACAGACCTGCCATGG + Intergenic
959405625 3:105958973-105958995 CTAGCAACACAGAAATACCTGGG + Intergenic
960360934 3:116710291-116710313 TCTGCCACACATAACTTCCCTGG + Intronic
960873661 3:122275754-122275776 GCTGCCACATAGAACTAATTAGG - Intronic
966829107 3:183990572-183990594 CCTGCCACACAGAAAGAGCCTGG + Intronic
968107948 3:196015638-196015660 GGTGCCACACAGCACTCCCTTGG + Intergenic
968114224 3:196077105-196077127 ACTGCCACACAGAAGAACCTAGG + Exonic
970376991 4:15468821-15468843 CATGCCACACAGGACCACATAGG + Intergenic
971220216 4:24698919-24698941 CCTGCCTCACAGAACCACACTGG + Intergenic
971864786 4:32155504-32155526 TCTTCAACACAGAACTATCTTGG + Intergenic
974408993 4:61514274-61514296 CCTGCCATACAGATCTCCCAAGG - Intronic
978976621 4:114883342-114883364 CCTGCACTACAGCACTACCTGGG + Intronic
981917365 4:150049632-150049654 CCTCCCACACAGACCTATATGGG - Intergenic
982754863 4:159205834-159205856 ACTGCTATAAAGAACTACCTGGG - Intronic
982805146 4:159754253-159754275 ACTGCTATAAAGAACTACCTGGG - Intergenic
983260870 4:165455022-165455044 CCTTCCCCACATAACTATCTTGG + Intronic
985469889 5:33703-33725 GGTGCCACACAGCACTCCCTTGG + Intergenic
988928755 5:36015012-36015034 ACTGCCATAAAGAAATACCTGGG - Intergenic
989113069 5:37926249-37926271 TCTGCCATACAGAGCCACCTGGG + Intergenic
990622524 5:57576233-57576255 ACTGCTATAAAGAACTACCTGGG - Intergenic
991562816 5:67972482-67972504 ACTGCGACAAAGAAATACCTGGG + Intergenic
994087847 5:95779833-95779855 CCTGACTCACAGAACCATCTTGG - Intronic
995395413 5:111681753-111681775 CCTGCCCCCCATAAATACCTGGG - Intronic
997481086 5:134185010-134185032 CCTGCCACTCAGTAGTCCCTTGG - Intronic
999828743 5:155299125-155299147 CCTGACACACAGAACTTGCTTGG + Intergenic
1001990525 5:176112513-176112535 CCTGACACAGAGAACAAGCTGGG - Intronic
1002226348 5:177725627-177725649 CCTGACACAGAGAACAATCTGGG + Intronic
1002267500 5:178045586-178045608 CCTGACACAGAGAACAATCTGGG - Intronic
1006573351 6:35023755-35023777 CCTGTCACCTAGAACTACTTTGG - Intronic
1008927882 6:56906403-56906425 CCTGCAGGAAAGAACTACCTGGG + Intronic
1009636303 6:66269083-66269105 GCTGCCACACAGAACCACGCAGG - Intergenic
1011370846 6:86634771-86634793 TCTGACACACAGAGCTACGTGGG - Intergenic
1011902405 6:92315080-92315102 ACTGCTAAAAAGAACTACCTGGG - Intergenic
1012407997 6:98923036-98923058 CCTTCTTCACAGAACTACCTTGG + Intronic
1012410567 6:98951686-98951708 CCTGCCCCATAGAATGACCTTGG + Intergenic
1012411660 6:98965385-98965407 CGTGCCACTCACAACTATCTAGG - Intergenic
1014242657 6:119034944-119034966 CTTGCCACACAGGAGTACGTTGG - Intronic
1016166681 6:140953932-140953954 ACTGCTATAAAGAACTACCTGGG - Intergenic
1016384332 6:143516003-143516025 CCTGCCACAGAGAACCACTCAGG - Intergenic
1016653850 6:146495038-146495060 ACTGCTATAAAGAACTACCTAGG - Intergenic
1017018894 6:150124285-150124307 ACTGCTATAAAGAACTACCTGGG + Intergenic
1017582460 6:155881388-155881410 CCTGCATAACAGAACTATCTAGG + Intergenic
1017705547 6:157119461-157119483 CCTGCCACACTGAACCTCTTGGG + Intronic
1019059460 6:169245217-169245239 GCAGCCACACAGCACTCCCTTGG + Intronic
1019869578 7:3747185-3747207 AGTGTGACACAGAACTACCTAGG + Intronic
1022415040 7:30170234-30170256 CTTCCCACACAGAAGTACTTTGG + Intergenic
1022427632 7:30284461-30284483 CCTACCACACCGCAGTACCTTGG + Exonic
1022819666 7:33946532-33946554 CCTGCCACTCAAAATCACCTGGG + Intronic
1023024732 7:36040371-36040393 CCTGCCACACAGGGCCACATGGG + Intergenic
1032661974 7:133994100-133994122 CCTGCCACAAACAGCTAACTAGG + Intronic
1033738580 7:144250013-144250035 ACTGCCATAAAGAACTACCCGGG + Intergenic
1034406978 7:150911106-150911128 CCTGCCACACACAAGGGCCTGGG + Intergenic
1034634154 7:152554043-152554065 AGTGCCATAAAGAACTACCTGGG - Intergenic
1035234042 7:157484759-157484781 CCTGCCACACTCAGCTACCTGGG - Intergenic
1037528312 8:19749537-19749559 CCTACCACACACATCTACCCTGG + Intronic
1043960064 8:86407400-86407422 CCTACAACAAAGAATTACCTGGG - Intronic
1045337092 8:101215565-101215587 CATGCCACACAGAGCCACATGGG - Intergenic
1045765046 8:105657515-105657537 CATGCCAAACAGAACTGCATTGG + Intronic
1046134572 8:110010155-110010177 ACTGCTATAAAGAACTACCTGGG - Intergenic
1049345846 8:142138170-142138192 CCTGCCCCGGAGAACCACCTGGG + Intergenic
1050333128 9:4565360-4565382 ACTGCTATAAAGAACTACCTGGG + Intronic
1050656435 9:7833607-7833629 TGTGTCACACAGAACTTCCTAGG + Intronic
1051562086 9:18453253-18453275 CTTGTCACCCAGAGCTACCTTGG - Intergenic
1052702208 9:31950876-31950898 CCTGCCACTCTGAACAGCCTTGG - Intergenic
1053538094 9:38946107-38946129 CATGCCACACAGGGCCACCTGGG + Intergenic
1054628040 9:67417814-67417836 CATGCCACACAGGGCCACCTGGG - Intergenic
1055097021 9:72424140-72424162 ACTGAAACACAGAACTCCCTGGG - Intergenic
1055108586 9:72537636-72537658 CAAGCTACACAAAACTACCTTGG - Intronic
1059659965 9:116390959-116390981 CCTACCACACAGAAGTATGTTGG - Intronic
1061120300 9:128637852-128637874 CCTGGCACACACCACTTCCTGGG - Intronic
1062104881 9:134749913-134749935 CTGGCCACACAGACATACCTAGG - Intronic
1062113241 9:134793996-134794018 CCAGCCATACAGATCCACCTTGG + Intronic
1062195035 9:135268308-135268330 CCAGCCACACAGAGCTTCCAGGG + Intergenic
1062732413 9:138117544-138117566 CTTGCCACACAGGACTATCCTGG - Intronic
1185919884 X:4079081-4079103 CGTGCTACACAGAACCACCTGGG - Intergenic
1186279188 X:7974521-7974543 GCTTTCTCACAGAACTACCTTGG - Intergenic
1186502695 X:10064787-10064809 CCTGCCACCCGGACCTGCCTGGG - Intronic
1186614264 X:11170398-11170420 CCTACCACACTGAGCTTCCTGGG - Intronic
1188974000 X:36651850-36651872 GCTGCCATAAAGAACTGCCTGGG + Intergenic
1190515035 X:51215177-51215199 CCTGGCTTACAGAAATACCTGGG + Intergenic
1193250710 X:79288363-79288385 GCTACCACACAGAACTCTCTGGG - Intergenic
1194188794 X:90808676-90808698 TCTGACACACGGAACTACGTGGG - Intergenic
1194855995 X:98929929-98929951 ACAGACACACAAAACTACCTAGG + Intergenic
1195278238 X:103303713-103303735 GCTGCCACAAAGAAATGCCTGGG + Intergenic
1200535377 Y:4390573-4390595 TCTGACACACGGAACTACGTGGG - Intergenic