ID: 926004770

View in Genome Browser
Species Human (GRCh38)
Location 2:9365294-9365316
Sequence CCCCTTGGATCCCCGAAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 72}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926004770_926004777 -3 Left 926004770 2:9365294-9365316 CCACCCTTCGGGGATCCAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 926004777 2:9365314-9365336 GGGCCCAGTTAACATCAGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 81
926004770_926004775 -7 Left 926004770 2:9365294-9365316 CCACCCTTCGGGGATCCAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 926004775 2:9365310-9365332 CAAGGGGCCCAGTTAACATCAGG 0: 1
1: 0
2: 0
3: 4
4: 97
926004770_926004782 11 Left 926004770 2:9365294-9365316 CCACCCTTCGGGGATCCAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 926004782 2:9365328-9365350 TCAGGGAGGAGCTGACCTTGGGG 0: 1
1: 1
2: 0
3: 25
4: 307
926004770_926004784 28 Left 926004770 2:9365294-9365316 CCACCCTTCGGGGATCCAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 926004784 2:9365345-9365367 TTGGGGTCTCCTGAGCTCAGCGG 0: 1
1: 0
2: 2
3: 28
4: 254
926004770_926004776 -6 Left 926004770 2:9365294-9365316 CCACCCTTCGGGGATCCAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 926004776 2:9365311-9365333 AAGGGGCCCAGTTAACATCAGGG 0: 1
1: 0
2: 0
3: 11
4: 104
926004770_926004780 9 Left 926004770 2:9365294-9365316 CCACCCTTCGGGGATCCAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 926004780 2:9365326-9365348 CATCAGGGAGGAGCTGACCTTGG 0: 1
1: 0
2: 1
3: 35
4: 339
926004770_926004781 10 Left 926004770 2:9365294-9365316 CCACCCTTCGGGGATCCAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 926004781 2:9365327-9365349 ATCAGGGAGGAGCTGACCTTGGG 0: 1
1: 0
2: 1
3: 19
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926004770 Original CRISPR CCCCTTGGATCCCCGAAGGG TGG (reversed) Intronic
904667173 1:32132217-32132239 CGCCTTGGCTCCCCAAAGTGCGG + Intronic
914901825 1:151715207-151715229 CCCCTGGGATCCCCGGTGTGTGG + Intronic
915004550 1:152623865-152623887 CTCCTTTGCTCCCCAAAGGGAGG + Intergenic
915366833 1:155321435-155321457 CGCTCTGGATCTCCGAAGGGGGG - Intronic
920933875 1:210412942-210412964 CTCCTTGGCTGCCCCAAGGGTGG - Intronic
1073331239 10:102671148-102671170 GCCCTGGGAGTCCCGAAGGGAGG + Intergenic
1073637318 10:105213242-105213264 CCCCTGGGATCCCTGAATGGAGG + Intronic
1081570365 11:44286909-44286931 CCCCATGGGTCTCCAAAGGGAGG - Intronic
1081586650 11:44389606-44389628 CCCCTTGGTGCCCAGCAGGGAGG - Intergenic
1083747612 11:64744559-64744581 CGCGCTGGATCCCCGGAGGGCGG - Intronic
1087297081 11:96389920-96389942 TCCCTTGGTCCCCGGAAGGGGGG - Intronic
1089112061 11:116064948-116064970 CCCCTAGGAACACAGAAGGGAGG - Intergenic
1101727125 12:107397103-107397125 CCCCTTGGAACCCCAGTGGGAGG + Intronic
1103602930 12:122065505-122065527 CTCCTGGCAACCCCGAAGGGTGG + Intergenic
1103927226 12:124429699-124429721 CCCCTTGGTCCCCAGCAGGGTGG - Exonic
1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG + Intronic
1112384131 13:98922115-98922137 TCCCTTGGTTCCCAGAAGGGTGG - Exonic
1113692900 13:112324260-112324282 CCCCTCTGAGCCCCGCAGGGAGG - Intergenic
1113811326 13:113144252-113144274 CTCCTTGGCTGCCCGGAGGGAGG - Intronic
1117251847 14:53946834-53946856 CCCCCTGGTCCCCCGCAGGGAGG + Intergenic
1118012532 14:61624550-61624572 CACCTTGGCTCCCCAAAGTGTGG + Intronic
1120653108 14:87158589-87158611 CTCCTTGGACTCCCGAAGTGCGG - Intergenic
1121507313 14:94486809-94486831 TTCCTTGGAGCCCCAAAGGGAGG + Intergenic
1121861253 14:97320937-97320959 CCACTTGCATCTCAGAAGGGTGG - Intergenic
1122811472 14:104291470-104291492 CCCCAGGGACCCCTGAAGGGGGG - Intergenic
1122985070 14:105208208-105208230 CCGCTTCCATCCCCAAAGGGTGG + Intergenic
1133294842 16:4746662-4746684 CCCCCTGGGTCCCTGCAGGGAGG + Intronic
1137590053 16:49687904-49687926 CTCCTTGGAGACCCCAAGGGAGG + Intronic
1141558945 16:84854018-84854040 CCCCTGGGAACTCCGGAGGGAGG + Intronic
1141656972 16:85421706-85421728 GCCCTTGGTTCCCCGAGGGAAGG - Intergenic
1141715862 16:85726516-85726538 CCCCCAGGATCCCCGCAGGCAGG + Intronic
1144758891 17:17695906-17695928 GCCTTTGGGTCTCCGAAGGGAGG + Intronic
1148462643 17:47847262-47847284 CCCCCGGGATACCCGCAGGGAGG + Exonic
1151343060 17:73484275-73484297 CCCCTTGGTTCCCTGAAGCCTGG - Intronic
1157511381 18:48277892-48277914 CCCCTTGCATCCTCAAAGAGAGG - Intronic
1159111901 18:64069491-64069513 CCACTTGGGTCCCAGAAGGTTGG - Intergenic
1160912542 19:1481607-1481629 CCCCGTGGAACCCCGAAGCCTGG - Exonic
1161672985 19:5624417-5624439 CCCTTTGAATCCCCCAAGGGAGG - Intronic
1166222855 19:41376776-41376798 CCCCTTGGATCCTCGGTGGCAGG + Exonic
1166932265 19:46308492-46308514 CCCCTTGGACCCCCCAGGGCAGG - Intronic
1167428971 19:49443455-49443477 CCCCTGGGACCCCAGAACGGAGG + Intergenic
925336590 2:3103015-3103037 CCACTTGGCTCCCCCCAGGGAGG + Intergenic
926004770 2:9365294-9365316 CCCCTTGGATCCCCGAAGGGTGG - Intronic
927965024 2:27262991-27263013 CCCCCGGGATCCCCGCAGGGCGG + Exonic
932483314 2:72063322-72063344 CCCTTTGGATCCCAGAAAGAAGG + Intergenic
935650650 2:105379022-105379044 CTCCTGGGATCCCAGAGGGGCGG - Intronic
937297459 2:120818182-120818204 CCGCTTTCATCCCCGAGGGGTGG + Intronic
947793625 2:232881109-232881131 CCCCTGGGGGCCCCGAGGGGAGG + Intronic
1180073778 21:45451480-45451502 CCCGTGGGATCCCGGAAAGGCGG - Intronic
1183300266 22:37055536-37055558 CCCCTAGGCTCCCAGAAGGCAGG - Intronic
1183735261 22:39641478-39641500 CCCTATGGATCCCAGCAGGGAGG + Intronic
952932815 3:38373253-38373275 GCCCTTGGATCTCTGAAGGAAGG + Intronic
959849566 3:111071398-111071420 CCCCGTGGACCCGCGAGGGGTGG + Intronic
962285209 3:134079322-134079344 CCCCTTGGATCCACGAGGACTGG + Intronic
968586165 4:1417082-1417104 CCCCCTGGATCCCCGCCAGGAGG - Intergenic
968914577 4:3491848-3491870 CCGCTGTGCTCCCCGAAGGGTGG + Intronic
1001608825 5:172983705-172983727 CCTCTGGGCTCCCCGAGGGGCGG + Intergenic
1003353935 6:5347160-5347182 CACCTTGGCCCCCCGAAGTGTGG + Intronic
1015300418 6:131646710-131646732 CCCCTAGGACCCTAGAAGGGAGG - Intronic
1019552112 7:1608292-1608314 CCCCCGGGATCCCCCATGGGAGG - Intergenic
1019552127 7:1608332-1608354 CCCCCTGGATCCCCCGTGGGAGG - Intergenic
1019938802 7:4273383-4273405 CCCATGGGGTCCCTGAAGGGAGG + Intergenic
1024609783 7:51054621-51054643 GCCCTCGGAACCCCTAAGGGAGG + Intronic
1029708638 7:102287808-102287830 CCCCCTGCAGCCCCGAAGTGGGG + Intronic
1031569696 7:123343707-123343729 ACGCTTGGATCTCAGAAGGGAGG - Intergenic
1032196314 7:129790861-129790883 CCCCTCAGATCTCTGAAGGGTGG + Intergenic
1035375145 7:158402730-158402752 GCCCTTGGATCCCTCTAGGGCGG - Intronic
1036755138 8:11466621-11466643 CCCCTGGGCTCCCGGAAGGTGGG - Exonic
1039875129 8:41578434-41578456 CCCCGGGGATCCCCGGCGGGTGG + Intronic
1040392894 8:46964539-46964561 CCCCTTGTATCCCAGCATGGTGG + Intergenic
1043533077 8:81171820-81171842 CACCTAGGAACCCGGAAGGGAGG - Intergenic
1057825970 9:98372184-98372206 CAACTTGGATCCCTGAAGGCTGG + Intronic
1061990137 9:134154308-134154330 CCCCTCGCCGCCCCGAAGGGTGG - Intronic
1062411822 9:136429572-136429594 TCCCTCGGATCCCCGAAAGGCGG + Exonic
1192213607 X:69142961-69142983 ACCCCTGGATCCCCGAGAGGCGG + Intergenic
1197252438 X:124229708-124229730 CCCTCTGCATCCCCCAAGGGTGG - Intronic
1199907691 X:152251093-152251115 CACCTTGGATCCAGGAAGGTGGG - Intronic
1200121531 X:153793456-153793478 CCCTTTGGAACCCAGAGGGGAGG - Intronic