ID: 926006369

View in Genome Browser
Species Human (GRCh38)
Location 2:9376216-9376238
Sequence TGAGCTGTGCTGCCGCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 152}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926006357_926006369 27 Left 926006357 2:9376166-9376188 CCCCAGAAAGAACTCATGCCCAC 0: 1
1: 0
2: 1
3: 12
4: 191
Right 926006369 2:9376216-9376238 TGAGCTGTGCTGCCGCCAGAGGG 0: 1
1: 0
2: 2
3: 18
4: 152
926006365_926006369 5 Left 926006365 2:9376188-9376210 CCAATGCAGTGTGGAGGGTGCCC 0: 1
1: 0
2: 0
3: 7
4: 137
Right 926006369 2:9376216-9376238 TGAGCTGTGCTGCCGCCAGAGGG 0: 1
1: 0
2: 2
3: 18
4: 152
926006358_926006369 26 Left 926006358 2:9376167-9376189 CCCAGAAAGAACTCATGCCCACC 0: 1
1: 0
2: 0
3: 14
4: 138
Right 926006369 2:9376216-9376238 TGAGCTGTGCTGCCGCCAGAGGG 0: 1
1: 0
2: 2
3: 18
4: 152
926006359_926006369 25 Left 926006359 2:9376168-9376190 CCAGAAAGAACTCATGCCCACCA 0: 1
1: 0
2: 0
3: 18
4: 172
Right 926006369 2:9376216-9376238 TGAGCTGTGCTGCCGCCAGAGGG 0: 1
1: 0
2: 2
3: 18
4: 152
926006363_926006369 9 Left 926006363 2:9376184-9376206 CCCACCAATGCAGTGTGGAGGGT 0: 1
1: 0
2: 0
3: 10
4: 92
Right 926006369 2:9376216-9376238 TGAGCTGTGCTGCCGCCAGAGGG 0: 1
1: 0
2: 2
3: 18
4: 152
926006364_926006369 8 Left 926006364 2:9376185-9376207 CCACCAATGCAGTGTGGAGGGTG 0: 1
1: 0
2: 1
3: 18
4: 154
Right 926006369 2:9376216-9376238 TGAGCTGTGCTGCCGCCAGAGGG 0: 1
1: 0
2: 2
3: 18
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926006369 Original CRISPR TGAGCTGTGCTGCCGCCAGA GGG Intronic
900400518 1:2471143-2471165 TGAGCTGGGCTGCCACCAGCTGG + Intronic
900671816 1:3858976-3858998 TGACCAGTTCTGCCTCCAGAGGG - Intronic
900801441 1:4739358-4739380 TGACCATTGCTGCCGACAGACGG - Intronic
902675559 1:18006256-18006278 TGAGCTGAGCTGTAGGCAGAGGG + Intergenic
906872061 1:49493949-49493971 TGATCTTTGCTGCCATCAGAGGG - Intronic
907046532 1:51303263-51303285 TGGGCAGTGCTGCCGGCACAGGG + Intronic
907617222 1:55937726-55937748 TGAGATGTGCTGGAGACAGAAGG - Intergenic
909815953 1:79994181-79994203 TCAGCTTTGCTGCCTGCAGATGG + Intergenic
911393141 1:97271182-97271204 TCAGCTGTGCTCCAGTCAGAGGG - Intronic
914903731 1:151727313-151727335 AGAGCTGTGCTGCAGCCAAGTGG - Intronic
916662551 1:166935812-166935834 TGTGCTAGGCTGCCTCCAGAGGG - Intronic
917217326 1:172691792-172691814 TGAGCTGTGCAGAAGACAGATGG - Intergenic
918764655 1:188464116-188464138 TGAGGTTTTCTGCCACCAGATGG + Intergenic
921403105 1:214748357-214748379 AGAGGTGTGCTGTCTCCAGATGG + Intergenic
922712793 1:227845795-227845817 TGGGCTGTGTTGCAGCCAGTAGG + Intronic
922740959 1:228014010-228014032 GCAGCTGTGCTGGAGCCAGAGGG + Intronic
1063114659 10:3065713-3065735 TCTGCTCTTCTGCCGCCAGAAGG + Intergenic
1067462532 10:46468297-46468319 AGGGCTCTGCTGCCTCCAGAGGG - Intergenic
1067624663 10:47916340-47916362 AGGGCTCTGCTGCCTCCAGAGGG + Intergenic
1070386214 10:75926982-75927004 TTAGGTTTGCTGCAGCCAGAGGG - Intronic
1072889244 10:99307100-99307122 TGAGCTATGCTGCTGCCTGCTGG + Intergenic
1076887917 10:133271034-133271056 TGAGCTGTGCCGTCCCAAGAAGG - Exonic
1077045981 11:545332-545354 TGAGCCGTGCGGGGGCCAGAAGG - Intronic
1077414749 11:2419827-2419849 TGAGGTATGCTGCCGCCAGAGGG - Intronic
1077873759 11:6285090-6285112 AGGGCTGTGGTGCAGCCAGACGG + Intergenic
1078923423 11:15852372-15852394 TGGGGTATGCTGCCACCAGATGG + Intergenic
1080013095 11:27477764-27477786 TTAGCTGTGCTTCCCTCAGAAGG + Intergenic
1082721239 11:56679569-56679591 TGAGCTGTGCTGCCCGGAGTTGG - Intergenic
1084260414 11:67974277-67974299 TGTGCTGTGCAGCCTCCACAGGG + Intergenic
1088375233 11:109133552-109133574 TGAGCACTGCTTCCTCCAGAGGG - Intergenic
1088769060 11:113014973-113014995 TTGGGTGTGCTGCCGCCAGCTGG + Intronic
1089742075 11:120591339-120591361 TGGGCTGTGATGCTGGCAGATGG + Intronic
1091313909 11:134597355-134597377 TTAGCTGTACTGCAGCCAGCAGG + Intergenic
1091387836 12:105885-105907 TGACCTAGGCTGTCGCCAGAGGG + Intronic
1096229903 12:49890959-49890981 TGAGCTGTGCAGCCCTGAGAGGG - Intronic
1097170222 12:57108502-57108524 AGAGCTGAGCTGTAGCCAGAGGG + Intronic
1100123120 12:91392652-91392674 TGAGCTGGGCTGAAACCAGATGG - Intergenic
1100883454 12:99043495-99043517 TCAGGTATGCTGCCACCAGATGG + Intronic
1105330035 13:19407509-19407531 TGAGCTGTGCTGCAGGCAGCAGG + Intergenic
1105861776 13:24421554-24421576 TGAGCTGTGCTGCAGGCAGCAGG - Intronic
1105918113 13:24936341-24936363 TGAGCTGTGCTGCAGGCAGCAGG + Intergenic
1113914737 13:113863607-113863629 GGAGCTGTGCAGCCGCGAGGAGG - Exonic
1113967487 13:114162293-114162315 TCAGCTGTGCTGTCTACAGAAGG + Intergenic
1118379344 14:65204922-65204944 TGCACTGCGCTGCAGCCAGAAGG - Intergenic
1120162875 14:81164300-81164322 TCAGCTGTGCTGCCTGTAGAGGG - Intergenic
1120232564 14:81856103-81856125 TGAGCTCTGCTGCCACCGTAGGG + Intergenic
1122378515 14:101285497-101285519 TGAGCTGGGCTGCAGGCACATGG + Intergenic
1122534832 14:102454936-102454958 TGAGCTGTGCTGGAGGCAGGAGG - Intronic
1122982472 14:105197850-105197872 AGCGCTGTGCTGGCTCCAGAGGG + Intergenic
1123145213 14:106123104-106123126 TGAGCTGTGCTGGTGGCTGATGG - Intergenic
1123184969 14:106507855-106507877 TGAGCTGTGCTGGTTCCTGAAGG - Intergenic
1123185423 14:106511966-106511988 TGAGCTGTGTTGGTGCCTGAGGG - Intergenic
1123196622 14:106623218-106623240 TGAGCTGTGCTGGTGCCTGATGG - Intergenic
1123205099 14:106704701-106704723 TGAGCTGTGCTGGTGTCTGACGG - Intergenic
1123210097 14:106751142-106751164 TGAGCTGTGCTGGTGTCTGACGG - Intergenic
1124648614 15:31458194-31458216 TCATCTGTGCTGCCATCAGAGGG - Intergenic
1125817166 15:42595858-42595880 ACAGCTGTGCTGCTGGCAGAGGG - Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1132372270 15:101307286-101307308 TGAGCTGTGCAGGCTCCAGCAGG - Exonic
1134314583 16:13106806-13106828 TGAGCTGTGTAGCCACCAGGTGG + Intronic
1136794379 16:33001916-33001938 TGAGCTGTGCTGGTGCCTGATGG + Intergenic
1136875529 16:33852464-33852486 TGAGCTGTGCTGGTGCCTGATGG - Intergenic
1139351933 16:66342482-66342504 TCAGCTGTGCAGCTGCCAGCAGG + Intergenic
1141645178 16:85363630-85363652 TGAGCTGTTTTCCCACCAGAGGG + Intergenic
1203096643 16_KI270728v1_random:1263596-1263618 TGAGCTGTGCTGGTGCCTGATGG + Intergenic
1142470053 17:158219-158241 TGGGGTGTGCAGCAGCCAGAAGG - Intronic
1142625205 17:1187371-1187393 GCTGCTGTGCGGCCGCCAGATGG - Intronic
1142891759 17:2948432-2948454 TGAGCTGGGGTGCGGCAAGAGGG + Intronic
1143445324 17:7005896-7005918 TCAGCTGAGCTGCCGCCCGACGG - Exonic
1144419259 17:15081124-15081146 AGAGCTGTGCTGGAGCCAGGTGG - Intergenic
1146256581 17:31394690-31394712 TCAGCTGTGCTGCTGCCTGCGGG + Intronic
1147668599 17:42163950-42163972 TGAGCGGGGCTGCGGGCAGAGGG + Exonic
1149343149 17:55707427-55707449 TGAGCTGAGCTGATCCCAGATGG - Intergenic
1150332674 17:64307044-64307066 TTATCTGTGCTGCCACCAGGTGG + Intergenic
1151636449 17:75352146-75352168 TGAGCTGTGTAGCTGCCTGAAGG - Intronic
1152103300 17:78315126-78315148 TGATCTGCTCTGCTGCCAGATGG + Intergenic
1153312412 18:3690139-3690161 TGAGCTGTGATTGCACCAGAGGG - Intronic
1155800981 18:30102729-30102751 TCAGCTTTGCTGCCTGCAGAAGG - Intergenic
1161026786 19:2040603-2040625 TGAGCTGAGCTGCCACCCCAGGG - Intronic
1161509054 19:4660588-4660610 TGAGATGTCCTGCCACAAGAGGG - Intronic
1161933590 19:7357334-7357356 TGAGCTGAGCAGCCACAAGAGGG - Intronic
1164563126 19:29307852-29307874 TGAGCTCTGCTTCAGCCAAATGG - Intergenic
1165323377 19:35099850-35099872 TGAGCTGTGCTGCCAGCACAGGG + Intergenic
925307892 2:2862852-2862874 TGAGCTGTGTTGTCCCCTGAGGG - Intergenic
926006369 2:9376216-9376238 TGAGCTGTGCTGCCGCCAGAGGG + Intronic
926210047 2:10862809-10862831 TGAGCTGTGCTGCTGGCCGCGGG + Intergenic
926754432 2:16223965-16223987 TGGGCTGAGCTGCTCCCAGAAGG + Intergenic
930098884 2:47588026-47588048 TGGGCTGTACTGCCGCCACAAGG - Intergenic
933556475 2:83836626-83836648 TGAGCTGAGATGGCGCCAGGAGG + Intergenic
933586376 2:84183797-84183819 AGAGCTGTGCTGATGCCAGTAGG - Intergenic
933918287 2:87018773-87018795 TCAGCTGTGCTCCCACCACAAGG + Intronic
934004709 2:87751140-87751162 TCAGCTGTGCTCCCACCACAAGG - Intronic
935767666 2:106385173-106385195 TCAGCTGTGCTCCCACCACAAGG - Intergenic
937318356 2:120946355-120946377 TGAGCTGAGCGGCCTGCAGAAGG + Intronic
938766959 2:134466328-134466350 TCAGGTGTGCTGCCACCAGGTGG + Intronic
939068955 2:137516944-137516966 TGAGCTGTGCAGAAGACAGATGG + Intronic
939708477 2:145484588-145484610 TGATCTCTTCTGCCCCCAGATGG + Intergenic
941468514 2:165857547-165857569 TGATCTGTACTGACTCCAGATGG + Intronic
942045832 2:172099046-172099068 TGAGCTCTGCAGCAGCCTGAGGG - Intergenic
942193989 2:173498846-173498868 GGAGCTGTGGTGCAGCCAGCTGG + Intergenic
943079980 2:183247478-183247500 TGAGCTGAGCTGGCCCCTGAAGG - Intergenic
947447233 2:230173219-230173241 TGAGCTGTGCTGCTGCCTGCTGG + Intronic
948460068 2:238124959-238124981 AGAGCTCAGCTGCCTCCAGAGGG + Intronic
948735177 2:239999015-239999037 GGAGCTGAGCTGCTGGCAGAGGG + Intronic
1171192569 20:23169720-23169742 CGAGCTGTGCTGCAGCCAGATGG + Intergenic
1172444345 20:34985245-34985267 TGAGCTGGGCAGCAGCCAGGGGG - Intronic
1172999576 20:39095964-39095986 TGAGCTGTGCTGCAGCTGGGTGG + Intergenic
1174424408 20:50421991-50422013 TCAGCTGTGCTGCCTCCTGAGGG - Intergenic
1178447393 21:32658591-32658613 TTAGCTCTGCTGCCTGCAGATGG - Intronic
1183349069 22:37324734-37324756 TGGGCTGAGCTGCAGCCGGAGGG - Intergenic
1184656620 22:45944979-45945001 TGAGCGGTGCTGCACCCATAGGG - Intronic
950089790 3:10287493-10287515 GGAGCTCTGCTGCAGCCACATGG + Intronic
951495116 3:23317051-23317073 TGAGCTGTGCTGCCTGGAGTTGG + Intronic
952746661 3:36788009-36788031 TGATGTGGGCTGCCCCCAGAAGG - Intergenic
954745131 3:52783431-52783453 TGAGCTTTTCTGCCCCCTGATGG - Intronic
956696931 3:71926372-71926394 TGAGCTTTCCTGCCACCAGGTGG + Intergenic
960543377 3:118884852-118884874 TGCCCTGTGCTGCCCCCAGGTGG - Intergenic
961487659 3:127227875-127227897 AGAGCTTTGCTGCAGCCTGAGGG + Intergenic
964018060 3:151972164-151972186 TGAGGTGTGCTGCCGCAGTAGGG - Intergenic
968525014 4:1052318-1052340 TGGGCTGTGCTGCAGGCAGTGGG - Intergenic
968789329 4:2648667-2648689 TCTGCTGTGCTGCCCCCACATGG - Intronic
969115476 4:4868352-4868374 TCTGCTGTGCTGACACCAGAGGG + Intergenic
970601221 4:17642293-17642315 AGAGATGTGCTGCGGCGAGATGG + Intronic
975043225 4:69770009-69770031 AGGGCTGTGGTGCAGCCAGAAGG + Intronic
976711814 4:88080429-88080451 TGAGCTCTACTGCATCCAGAGGG + Intergenic
980013608 4:127623312-127623334 GGAGCTGTGCGGGGGCCAGACGG + Intronic
984825986 4:183924862-183924884 ATAGCTGTGCTGGCGTCAGAAGG + Intronic
985667420 5:1188439-1188461 TGAGTTATGCTTCCGCCAGCAGG - Intergenic
985670627 5:1204758-1204780 ACAGCTGTGCTGGCGCCACATGG - Intronic
991426313 5:66495763-66495785 TGACCTGTGCTGCCTTCAGCAGG - Intergenic
991622364 5:68558143-68558165 TGAGTAGTGCTGCCCCTAGAAGG - Intergenic
999264324 5:150256596-150256618 TGTGCTGCACTGCCACCAGATGG - Exonic
1003803767 6:9702104-9702126 TGAACTGAGCTGCAGCCAGCTGG - Intronic
1006129289 6:31859699-31859721 TGAGCTGTGCCACTGCCACAGGG - Exonic
1010896982 6:81376913-81376935 TGAGCTGTGCTGGTGCCTGAGGG - Intergenic
1015392878 6:132702570-132702592 TGAGCTGTGCTGCCTGGAGTTGG - Intronic
1016751556 6:147635820-147635842 TCAGCTGTGTTGGCCCCAGAGGG - Intronic
1016801937 6:148177814-148177836 TGAGCCGTGCTGCCCCCTGCTGG - Intergenic
1018128500 6:160705301-160705323 TCAGCTGTGCTCCCACCACAAGG - Intronic
1018577336 6:165273542-165273564 TGAGCTATCCTACCACCAGATGG + Intergenic
1018623143 6:165751051-165751073 TGAGCTGTGCTGTCTCCTGGGGG + Intronic
1021028843 7:15703860-15703882 TGTGCTGTGCTTGCCCCAGAGGG + Intergenic
1023652656 7:42388075-42388097 TCAGCTGTGCTGGCGTCAGTCGG + Intergenic
1023679005 7:42664373-42664395 TGAGATGTGCTGTCGGGAGATGG - Intergenic
1024829184 7:53428026-53428048 TGATCTGTGATGCTGCCATAAGG + Intergenic
1026854351 7:73743198-73743220 TCAGCTGTGCTGGCACCAGTCGG + Intergenic
1028601523 7:92605824-92605846 AGAGCTGTGCTGCACCCACAGGG + Exonic
1031995490 7:128227743-128227765 TGAGCTGTGCTGCCGAGAGGAGG + Intergenic
1033776900 7:144621175-144621197 TGTGATGTGCTGCCTCCTGAAGG - Intronic
1033877727 7:145842858-145842880 CGAGCTGTGCTGCCTGCAGTTGG + Intergenic
1034456282 7:151172700-151172722 TGTGCGCTGCTGCCACCAGAGGG - Intronic
1035458193 7:159023194-159023216 TGGGCTGTGCTGAGGACAGAAGG + Intergenic
1037801157 8:22036725-22036747 TGGGCTGTGCTGCAGGCACAGGG + Exonic
1039012149 8:33105595-33105617 TGAGCTGTGCTGACAGCTGAAGG + Intergenic
1044439666 8:92208759-92208781 TGGGCTGTGGTGCAGCCAGCTGG - Intergenic
1046269386 8:111873792-111873814 TGAGCTGAGCTGGCTACAGAAGG + Intergenic
1046766388 8:118074448-118074470 TGAGCTGTGGTGCAGGCAGAGGG + Intronic
1047536704 8:125726652-125726674 TGCTCTGTGCTGTAGCCAGAGGG - Intergenic
1047857883 8:128932415-128932437 TGTGCTATGCTGCCTCCACATGG + Intergenic
1049038751 8:140097084-140097106 GGAGCTGTGTTGCAGTCAGAAGG + Intronic
1050276813 9:4009274-4009296 TCAGCTGTGCTGCAGACACAAGG + Intronic
1051225379 9:14893068-14893090 AGAGCTGTGGTGCAGCCAGCCGG + Intronic
1057907413 9:98993510-98993532 TGAACTGTGGTGCAGACAGACGG - Intronic
1058879944 9:109277562-109277584 TGATCGGTGCTGATGCCAGAAGG + Intronic
1059333998 9:113557305-113557327 GTAGCAGTGCTGCTGCCAGAAGG + Intronic
1060926689 9:127460363-127460385 GAAGCTGTGCTCCCTCCAGAAGG - Intronic
1061926671 9:133809268-133809290 TGTGCAGTGCTGCAGCCAGATGG + Intronic
1186653497 X:11587666-11587688 TGAGCTGTGCTGCTCCCATTGGG + Intronic
1187268295 X:17757130-17757152 TGTCCTGTGCAGCCACCAGAAGG - Intergenic
1192546956 X:72022182-72022204 TTAGCAGTGCTGCCGCCTGTTGG + Intergenic
1193187484 X:78530131-78530153 TGTTCTGTGCTGCTGACAGATGG - Intergenic
1195682641 X:107560395-107560417 TGAGTTGTGCTGCGGCCCGTTGG + Intronic
1196552462 X:117045382-117045404 TGAGCTGTGCTGCCCGCAGTTGG - Intergenic