ID: 926012112

View in Genome Browser
Species Human (GRCh38)
Location 2:9416690-9416712
Sequence TTGTAGGCCTAAAGTTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926012112 Original CRISPR TTGTAGGCCTAAAGTTGTGG AGG (reversed) Intronic
901473310 1:9472577-9472599 TTGTTGGCTTCAAGTTGTGATGG - Intergenic
907501208 1:54882815-54882837 TTGTTTGCCTAAGGCTGTGGGGG + Intronic
911580155 1:99624851-99624873 TTCTAGGCATAAAGATTTGGGGG + Intergenic
916795763 1:168165688-168165710 TTATAGGCCTCAAGTGGTGGGGG - Intergenic
921196210 1:212760247-212760269 TGGTGTGCCTAAAGTTGTGGTGG - Intronic
924177172 1:241403047-241403069 TTGTTGGCTTACAGTTCTGGAGG - Intergenic
1064067103 10:12191519-12191541 TTGTTGGCCTGCAGTTTTGGGGG - Intronic
1067722844 10:48742850-48742872 TTGTTGGCCTGAAGTCGTTGAGG + Intronic
1068680677 10:59816742-59816764 TTGTAGGACTTACATTGTGGAGG - Intronic
1078543194 11:12228039-12228061 ATGGAGGCCTATGGTTGTGGTGG + Intronic
1080337699 11:31217083-31217105 TTGTAGGCTTAATGTAGAGGAGG - Intronic
1085336495 11:75700760-75700782 TTGTGGGCCAAAAGTTGCGAGGG + Intergenic
1086353254 11:85965281-85965303 TTATTGGCTTACAGTTGTGGAGG - Intronic
1086856384 11:91871288-91871310 TTCTAAGCCTAAGGTAGTGGTGG - Intergenic
1090740319 11:129654131-129654153 TTGTTCCCCTGAAGTTGTGGGGG - Intergenic
1092808506 12:12250063-12250085 TTTTAGGCCTAAAGTCATGAAGG - Intronic
1093537041 12:20234577-20234599 TTGTAGGCCAAAGATTGTGCTGG - Intergenic
1095187381 12:39216400-39216422 TTGTTGTCCTCAAGTTGTGTAGG - Intergenic
1095914144 12:47458991-47459013 TGGTAGGCCTTAACTTCTGGAGG - Intergenic
1098185644 12:67893281-67893303 TAGTAGGCAAGAAGTTGTGGAGG + Intergenic
1100935976 12:99666519-99666541 TTGTAGGGGTAAATTTGTAGGGG + Intronic
1102290190 12:111692921-111692943 TTGTGGGACTAGAGTGGTGGTGG + Intronic
1102658896 12:114507710-114507732 CTTTAGGCCTAATGTTGGGGGGG + Intergenic
1106662983 13:31821801-31821823 ATGTAGGCCTAAAATAGAGGTGG - Intergenic
1106895799 13:34301095-34301117 TTGTAGGTGGAAAGATGTGGAGG - Intergenic
1109325385 13:60861208-60861230 TTATAGGGCTAAAGTGGTTGGGG + Intergenic
1109393255 13:61720965-61720987 TTTTAGGCTTAAAGCTGAGGGGG - Intergenic
1110124110 13:71920649-71920671 ATGTTGGCTTAAAGTTATGGTGG - Intergenic
1111745761 13:92266981-92267003 TTGTAGAAATAAAGTTTTGGTGG - Intronic
1118314991 14:64720729-64720751 TTGTTGTCTTAAAGTTCTGGAGG + Intronic
1121929438 14:97958946-97958968 TTGTTGTCTTAAAGTTCTGGAGG - Intronic
1123764452 15:23462918-23462940 TTGTAGAAATAAAGTTTTGGTGG - Intergenic
1124081340 15:26501079-26501101 CTGTGGGCCTATAGTGGTGGTGG - Intergenic
1125929734 15:43591803-43591825 TTGAAGGGCTAGAGTGGTGGAGG - Intergenic
1125942901 15:43691635-43691657 TTGAAGGGCTAGAGTGGTGGAGG - Intergenic
1126716724 15:51525666-51525688 CTGTAGGCCTGAAGTCCTGGTGG + Intronic
1130969845 15:88723577-88723599 TTATAGGCCTTAAGTTGGGAGGG + Intergenic
1131229328 15:90648301-90648323 TTCAAGGGCTAAAGTTGAGGGGG - Intergenic
1139877966 16:70161586-70161608 TTGTTGGCCTGAAGTGGTGGCGG - Exonic
1140714372 16:77708626-77708648 TTATATACCAAAAGTTGTGGGGG + Intergenic
1145400695 17:22529963-22529985 TGGAAGGCCTAGAATTGTGGGGG - Intergenic
1146461092 17:33046611-33046633 ATGGAGGGCTAAGGTTGTGGTGG - Intronic
1149562052 17:57615076-57615098 TTGTAGGCCTGAACCTGTTGGGG + Intronic
1155160695 18:23193069-23193091 TTGGAGGCCTAGAGTTGGGTGGG + Intronic
1162457417 19:10793957-10793979 CTCTAGGCCTGAACTTGTGGTGG + Intronic
1166610941 19:44195668-44195690 TTGTATGTGTAAGGTTGTGGTGG + Intergenic
926012112 2:9416690-9416712 TTGTAGGCCTAAAGTTGTGGAGG - Intronic
928598282 2:32878121-32878143 CTGTAGGCCCAAACTTGTGTAGG - Intergenic
928598300 2:32878221-32878243 TTGTAGGTCCAAAGTTGTATTGG + Intergenic
929648675 2:43655683-43655705 TTGAAAGCCTAAGGTTGTGTGGG + Intronic
931070448 2:58642373-58642395 TTGTAGGACTACAGTCTTGGCGG - Intergenic
932963995 2:76449026-76449048 TTATATGCCCACAGTTGTGGAGG + Intergenic
936579627 2:113686723-113686745 TTGTAGGACTAAAGTTGCTTTGG - Intergenic
940439709 2:153700042-153700064 TTATTGGCCTAAAGTTTTGGGGG - Intergenic
940753367 2:157653749-157653771 TTGTTGGCTTAAAGTTCTAGAGG + Intergenic
942627060 2:177912537-177912559 TTATTTCCCTAAAGTTGTGGGGG - Intronic
944869751 2:203898019-203898041 TTGTGGGCATAAAGCTTTGGGGG + Intergenic
945826362 2:214724848-214724870 TTTTAGGCCTCAAGTGGAGGTGG + Intergenic
947145528 2:227060582-227060604 TTGTAGGGGTAAAGAGGTGGTGG + Intronic
1168778063 20:464585-464607 GTTTAGTCCTAGAGTTGTGGTGG - Intergenic
1172532200 20:35639850-35639872 GTGTAGGCCTCAATTTCTGGTGG + Intronic
1173471478 20:43326571-43326593 TTGAAGGCCAAAAGTGGGGGAGG - Intergenic
1174805208 20:53599247-53599269 TTGTGAGCCTAGAGTTTTGGGGG + Intronic
1179158997 21:38876517-38876539 TTACAGGCCTGTAGTTGTGGAGG + Intergenic
1180023341 21:45143309-45143331 TTGGATGTCTTAAGTTGTGGAGG - Intronic
952996722 3:38890174-38890196 TTGTAGGGCAAAAGCTCTGGGGG + Intronic
955495090 3:59522683-59522705 TTGTAGGCCAAAAGTGGATGTGG + Intergenic
957560451 3:81814386-81814408 TTTAAAGCCTAAACTTGTGGAGG + Intergenic
959816944 3:110684701-110684723 TTGTAGGCTAAAAATTGAGGCGG - Intergenic
960934570 3:122890149-122890171 TTGGAGGCATGGAGTTGTGGTGG + Intergenic
961986278 3:131138280-131138302 CTGTAGGCCTGTAGTGGTGGTGG + Intronic
962845482 3:139270372-139270394 TTGGATGCCTGAAGTTGTAGAGG + Intronic
972639442 4:40912262-40912284 TTGTAGGCCTTAGGCTGCGGTGG - Intronic
981409380 4:144410843-144410865 TTGTAGTACTGAAGTTTTGGAGG - Intergenic
987834382 5:23142778-23142800 TTGCAGGGATAAAGCTGTGGTGG + Intergenic
988219424 5:28323471-28323493 TTGAAGGTATAAAGTTTTGGAGG - Intergenic
991712406 5:69420464-69420486 TGGTTTGCCTAAAGTTATGGAGG + Exonic
995909021 5:117163495-117163517 TTGAAAGCCCAAACTTGTGGAGG - Intergenic
996757374 5:126948924-126948946 TTGTCGGCCTACAGTGGTGGAGG + Intronic
999493151 5:152071264-152071286 ATGCAGACCTAAAGTTGAGGAGG - Intergenic
1011858631 6:91726841-91726863 AGGTAGGCCTAGAATTGTGGGGG - Intergenic
1014151924 6:118067233-118067255 TTGTTGGGGTAAAGTTGGGGAGG + Intronic
1018797370 6:167196786-167196808 GGGTAGTCCTAAAGTTTTGGTGG - Intronic
1018818927 6:167357978-167358000 GGGTAGTCCTAAAGTTTTGGTGG + Intronic
1021640683 7:22733530-22733552 TTGTAGGCATATAGTGGTAGGGG + Intergenic
1031116623 7:117675971-117675993 TTGTTGGCTTACAGTTCTGGAGG - Intronic
1037492007 8:19405511-19405533 TTATAAGCCTAATGGTGTGGAGG - Exonic
1041327909 8:56688815-56688837 TTGTCAGCTTAAAGTGGTGGGGG + Intergenic
1043029323 8:75112623-75112645 TTTTAGTCTTAAATTTGTGGAGG + Intergenic
1044267611 8:90202204-90202226 TTGTAGGCATAAAGATGAGATGG - Intergenic
1044481806 8:92699334-92699356 TTGTAGGCATAGAGTGGGGGAGG + Intergenic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1056379876 9:86047352-86047374 TTGTAGGTCTAGTGTTGTGAGGG - Intronic
1058233114 9:102455557-102455579 TTGTAGTTCTAAAGCTGTTGAGG + Intergenic
1187090032 X:16086438-16086460 TTTTATGCCTAAAGCTGTGGAGG - Intergenic
1190479936 X:50866048-50866070 TTGTAGGGAAAAAGTTGGGGTGG - Intergenic
1190523487 X:51304401-51304423 TGGTAGGGGTGAAGTTGTGGGGG + Intergenic
1193149147 X:78106453-78106475 TTGTAGGCCTACTTTTTTGGAGG + Intronic
1195939999 X:110160035-110160057 CTGTGGGCCTAAAGCTGTGTGGG - Intronic
1197107966 X:122738511-122738533 ATGAAGGCCTAAATTTGTAGTGG + Intergenic
1201467882 Y:14304436-14304458 TTGTCAGCCTAAGGTGGTGGAGG + Intergenic
1202203217 Y:22376469-22376491 TAGTAGGCCTAAATTTCTGTTGG - Intronic