ID: 926012921

View in Genome Browser
Species Human (GRCh38)
Location 2:9423040-9423062
Sequence CGCCTCCCGCCTCTCAGGGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 129}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926012921_926012930 1 Left 926012921 2:9423040-9423062 CCGACCCTGAGAGGCGGGAGGCG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 926012930 2:9423064-9423086 CCGAAGCGGGGCAGAGGAAGAGG 0: 1
1: 0
2: 2
3: 17
4: 261
926012921_926012931 6 Left 926012921 2:9423040-9423062 CCGACCCTGAGAGGCGGGAGGCG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 926012931 2:9423069-9423091 GCGGGGCAGAGGAAGAGGCAAGG 0: 1
1: 1
2: 4
3: 102
4: 1034
926012921_926012928 -5 Left 926012921 2:9423040-9423062 CCGACCCTGAGAGGCGGGAGGCG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 926012928 2:9423058-9423080 AGGCGGCCGAAGCGGGGCAGAGG 0: 1
1: 0
2: 1
3: 19
4: 226
926012921_926012932 12 Left 926012921 2:9423040-9423062 CCGACCCTGAGAGGCGGGAGGCG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 926012932 2:9423075-9423097 CAGAGGAAGAGGCAAGGAAACGG 0: 1
1: 0
2: 17
3: 141
4: 1373
926012921_926012933 19 Left 926012921 2:9423040-9423062 CCGACCCTGAGAGGCGGGAGGCG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 926012933 2:9423082-9423104 AGAGGCAAGGAAACGGCCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926012921 Original CRISPR CGCCTCCCGCCTCTCAGGGT CGG (reversed) Exonic
900244408 1:1630798-1630820 CGCCTCCCGCCCCCCAGGCCCGG + Intergenic
900363396 1:2300691-2300713 CGACTCCCGGCTCTCAGGGCGGG - Intronic
900719657 1:4167077-4167099 TGGCTCCTGCATCTCAGGGTGGG - Intergenic
901641198 1:10694069-10694091 CGCCGCCCGCTTCTCACGCTCGG + Intronic
901654581 1:10762103-10762125 CCCCTCCTGCCTCCCAAGGTTGG + Intronic
903847680 1:26288233-26288255 CTCCTGCCGCCTCCCAGGGCCGG + Intronic
904837908 1:33350570-33350592 CGCCTCGCGCTCCTGAGGGTGGG - Intronic
907043997 1:51288540-51288562 TGCCTCCTGCCTTCCAGGGTAGG - Intronic
907344965 1:53769061-53769083 TGCCTCAGGCCTCTCAGTGTTGG - Intronic
907395540 1:54187228-54187250 CTCCTCCTGGCTCTCAGGCTGGG + Intronic
908572130 1:65420848-65420870 CCCTTCCCGCCTCTCCGGTTCGG + Intronic
910251259 1:85201117-85201139 CGCCTCCGCCCCCTCAGGCTCGG + Intergenic
918078868 1:181190612-181190634 CCCCTCCCTCCTCATAGGGTGGG + Intergenic
919809643 1:201400362-201400384 TGCCTCCTTCCTCTCAGGGCAGG - Intergenic
923497012 1:234534564-234534586 CGACTCCCGCCCTTCAGGGGAGG + Intergenic
924596261 1:245447558-245447580 CGCCTCCCACCTCGAAGGGAGGG - Intronic
1062898026 10:1119695-1119717 CGCCTCCCTCCTCCCAGCGAAGG - Intronic
1064274340 10:13892240-13892262 TGTCTCCGGGCTCTCAGGGTAGG - Intronic
1069898695 10:71694904-71694926 CGTCTCCAGCCTCTCTGGCTGGG - Intronic
1071326404 10:84523098-84523120 TGCCTCCTGCCTCCCAGGCTGGG + Intergenic
1073147704 10:101291657-101291679 GGCCTCCCGCGTGGCAGGGTGGG - Intergenic
1076148820 10:128146767-128146789 TGCCTCCCGCCTCTCAAGGATGG - Intergenic
1077109054 11:854112-854134 CTCTTCCCGCCTGTCAGGGATGG + Intronic
1077983985 11:7332233-7332255 CGGCCCCCTCGTCTCAGGGTGGG - Intronic
1078750952 11:14163409-14163431 GGGCTCCCGCCTGTCAGGCTGGG + Intronic
1082821295 11:57546186-57546208 GGCCTCCTGCCTCTCTGGCTTGG + Intronic
1083749995 11:64755602-64755624 TGCCTCCCTCCCCTCAGGGCTGG + Intronic
1084544039 11:69805073-69805095 GGCCTCCTGCCTCCCAGGGGTGG - Intergenic
1084944784 11:72632725-72632747 GCCCTCCCTCCTCTCAGGGGAGG - Intronic
1089071983 11:115707599-115707621 CACCTCCAGCCTCTCTGGGATGG - Intergenic
1089343629 11:117776462-117776484 TGCCTCCCGTCCCTCAGGGCTGG + Intronic
1090295437 11:125583748-125583770 CACCTCCCGCCTGCCAGGGAAGG + Exonic
1092029729 12:5274296-5274318 AGCCTTCCGTCTCTCAGGGGTGG + Intergenic
1101613442 12:106313179-106313201 AGCCTTCCTCCTCACAGGGTTGG - Intronic
1102151078 12:110689327-110689349 TGCCTCCCGCCCCGCAGGGTGGG + Intronic
1104652136 12:130543024-130543046 CCCTTCCCGTCTCTCAGGGTTGG + Intronic
1108152676 13:47552636-47552658 CCCCTTCTGCCTCTCAGGCTAGG - Intergenic
1110277140 13:73653078-73653100 GGCATCCCCCCTCTCAGAGTGGG + Intergenic
1117003530 14:51395427-51395449 CTCCTTCCACCTCTTAGGGTGGG + Intergenic
1122235572 14:100329147-100329169 GGCCTCCTGCCTCCCAGAGTGGG + Intronic
1202892871 14_KI270722v1_random:175964-175986 CGCCTTTAGCCTCTCTGGGTTGG - Intergenic
1124960531 15:34389969-34389991 CCCCTCCCCTCTCTCAGAGTGGG - Intronic
1124977160 15:34536190-34536212 CCCCTCCCCTCTCTCAGAGTGGG - Intronic
1131200129 15:90388655-90388677 CGCCTCTCGCCGCCCAGGCTCGG + Intronic
1131277584 15:90994741-90994763 CGCCTCCCGCTTCCCTGGCTTGG + Intronic
1132496764 16:266990-267012 CAACTCCGGCTTCTCAGGGTGGG - Intronic
1139613581 16:68075736-68075758 CGCCTCCCACAACTCAGGGCAGG + Intronic
1142636339 17:1260104-1260126 CGGCTCCAGCCTCCCAGGGTCGG - Intergenic
1143503149 17:7350468-7350490 CGAATTACGCCTCTCAGGGTGGG - Intronic
1143628498 17:8124026-8124048 CCCCTCCCGCCTCTCACCTTGGG + Exonic
1146673285 17:34756601-34756623 GGCCTCCTGGCTTTCAGGGTGGG + Intergenic
1151384455 17:73746636-73746658 CGCCTCCCCCATCTCCGGGGAGG - Intergenic
1152068984 17:78125925-78125947 GGCCTCCCTCCCCTCAGGATGGG + Intronic
1152738393 17:82008543-82008565 TCCCTCCCGCATCCCAGGGTGGG + Intronic
1156253831 18:35376976-35376998 CGCCGCGCGCCTCCCAGGCTGGG + Intronic
1156405936 18:36782772-36782794 CGCCTCCTGGCTTTCAGGGCAGG - Intronic
1157189398 18:45568081-45568103 CCCCCACCGCCTCTCAGGATTGG - Intronic
1160775969 19:855885-855907 TGCCCGCCGCCTGTCAGGGTTGG - Intronic
1164034410 19:21440309-21440331 CGCCCCAAGCCTCTCTGGGTCGG + Intronic
1165171369 19:33894319-33894341 TGCCTCTCCCCTCTCAGGGAAGG - Intergenic
1165827075 19:38711591-38711613 CACCACCCACCTCCCAGGGTGGG - Intronic
1166675667 19:44739121-44739143 AGACTCCTCCCTCTCAGGGTAGG - Intergenic
1167614225 19:50523070-50523092 TGGCTGCCGCCTCTCAGGGCTGG + Intronic
1167638724 19:50668805-50668827 CCCCTCCAGCCTCGCAGGCTGGG + Exonic
1167792196 19:51689552-51689574 CGGCTCCCGCGTCGCAGGGAAGG - Intergenic
1168643813 19:58047154-58047176 CTCCTGACGCCTCTGAGGGTGGG - Intronic
926012921 2:9423040-9423062 CGCCTCCCGCCTCTCAGGGTCGG - Exonic
926130717 2:10302176-10302198 CGCCTCCTGGCTCTCGGGGAGGG - Intergenic
927782168 2:25948303-25948325 CTCCTACTGCCTCCCAGGGTTGG - Intronic
928696919 2:33858654-33858676 AGCCTTCCTCCTCTCAGGATGGG - Intergenic
933778670 2:85787009-85787031 AGCCTACAGCCTCTCAGGGTCGG + Exonic
933988997 2:87620032-87620054 CCCCTCCCACCTCTCCTGGTGGG - Intergenic
936304846 2:111330794-111330816 CCCCTCCCACCTCTCCTGGTGGG + Intergenic
936713811 2:115162091-115162113 CGCCTCCCGCTTCCCAGGCTGGG + Intronic
938942675 2:136182686-136182708 ATCCTCCTGCCTCTGAGGGTAGG + Intergenic
942565946 2:177264759-177264781 CGCCTCCCGCCCCACAAGGGCGG + Exonic
947385586 2:229587322-229587344 CCTCTCCCGCCTCTCCGGATGGG + Intronic
948462927 2:238138956-238138978 CCCCTCCCACCTCTCCGGCTGGG - Intronic
949024889 2:241762645-241762667 AGGGTCCCGCCTCTCAGGTTTGG + Intronic
1171567766 20:26209665-26209687 CGCCTTCTGCCTCGCGGGGTGGG - Intergenic
1174165005 20:48578227-48578249 TGCCTCCCACCTCTCAGACTCGG + Intergenic
1175946698 20:62562272-62562294 TGCCTCCCGCCTCCCAGGCATGG - Intronic
1176168709 20:63687621-63687643 CGCCCCCCGCCCCACAGGGAAGG + Exonic
1181287529 22:21764946-21764968 CTTCACCCGCCTCACAGGGTAGG + Intronic
1182288028 22:29259467-29259489 GCCCTCCCGCATCTCAGGTTGGG + Exonic
1183406282 22:37632190-37632212 TGCCTCCCTCCTCTCAAGGCAGG + Intronic
1183456824 22:37927418-37927440 CGCCTCCCGCCTCTCGCACTCGG + Exonic
1183969804 22:41468475-41468497 CGTTTCCCGCCTCTCAGGCGCGG - Intronic
953406863 3:42664063-42664085 TGCTTCCTGCCTCCCAGGGTTGG + Intronic
959513529 3:107240631-107240653 CGCCTCCCGCCGCGCAGGCTCGG - Intergenic
961455833 3:127023443-127023465 CTCCTCCCACCTCTCAGGAGTGG - Intronic
961635384 3:128329755-128329777 CAGCTCCCGCCCCTCAGGGCAGG - Intronic
963102704 3:141621997-141622019 CACCTCCCTCCTCTCAGGTGTGG - Intergenic
967833438 3:193941752-193941774 GGCCTCCTGCCTCTCAGCCTGGG - Intergenic
968518824 4:1026559-1026581 GGGCTCCAGCCTCTCAGGCTTGG - Exonic
968708556 4:2095644-2095666 CACATCCAGCCTCTCAGGGGAGG - Intronic
968843623 4:3026709-3026731 GCTCTCCCGCCTCCCAGGGTGGG + Intronic
970188022 4:13483788-13483810 AGCTTCCCGCCTCTCAGGACTGG - Intronic
972109654 4:35541613-35541635 CTCCTTCAGACTCTCAGGGTTGG - Intergenic
974875704 4:67700909-67700931 CGCCCCTCGCCTCCCAGGGCCGG + Intronic
981531912 4:145761730-145761752 GCCCTGCCGCCTCTCAGGGGTGG + Intronic
985561306 5:587559-587581 AGGCTGCCGCTTCTCAGGGTGGG + Intergenic
987794039 5:22605530-22605552 CACCTCCCACCTCTGAAGGTTGG + Intronic
991351122 5:65721867-65721889 CGCCTCCCGCCGCTCCGGACCGG - Intronic
995943609 5:117614749-117614771 CTCCTCCCGGGGCTCAGGGTAGG + Intergenic
1002065151 5:176648038-176648060 CGCATCCCACATCCCAGGGTAGG - Intronic
1006582258 6:35083853-35083875 CCCCTCCCACCTTCCAGGGTGGG - Intronic
1007805130 6:44438029-44438051 TGCCTCCAACCTCTCAGGCTTGG + Intronic
1011128758 6:84033778-84033800 CGCCTCCCACCGCCCAGGGCCGG - Exonic
1019803957 7:3108874-3108896 CGCCTCCTGCCTCCCTGGGCTGG - Intergenic
1020347687 7:7182875-7182897 GCCCTCCCCCCTCTCCGGGTTGG + Intronic
1020707031 7:11558116-11558138 TGCCTCCCACATCTCAAGGTTGG - Intronic
1021798734 7:24284069-24284091 CTCCCCCCGCCACTCAGGGGCGG + Intergenic
1024232595 7:47374015-47374037 CTGCTCCCGCCTCTCACGGATGG - Intronic
1024498043 7:50070259-50070281 CGCCCCCAGCCACTCTGGGTTGG + Intronic
1031391145 7:121216572-121216594 AGACTCCCACCTCTCTGGGTAGG - Intronic
1032194315 7:129780600-129780622 CCCCTCCCCCCTCCCAGGGTCGG - Intergenic
1032794781 7:135268831-135268853 CGCATCCCGGCTCTCAGGGAGGG - Intergenic
1033241215 7:139681528-139681550 CGCCTCCTCCCGCTCAGTGTGGG + Intronic
1034116366 7:148587248-148587270 TGCCTTCAGGCTCTCAGGGTGGG - Intergenic
1034698399 7:153075303-153075325 TCCCTCCTGCCTCTCTGGGTGGG + Intergenic
1035159901 7:156942970-156942992 CGGCACCCTCCTCTCAGGCTGGG + Intergenic
1038310014 8:26439307-26439329 CACCTCCTGCCTCTCAGGGCTGG - Intronic
1039512731 8:38104950-38104972 CGCTTTCCGCCTCTCACAGTAGG + Intergenic
1043233337 8:77830335-77830357 CCCATCCCTCCTCACAGGGTGGG + Intergenic
1051335617 9:16063366-16063388 CACCTCCTGCTTCTCAGAGTGGG - Intergenic
1058386655 9:104444501-104444523 CTCTTCCCACCTCTCAGGGCTGG + Intergenic
1059972189 9:119679218-119679240 CCCCTGCCCCTTCTCAGGGTGGG + Intergenic
1061055801 9:128222373-128222395 CGCCCCCAGCCTCTCAGCGTGGG + Intronic
1061511051 9:131061170-131061192 CACCTCCCGGCTCTCTGGGATGG - Exonic
1061793051 9:133068592-133068614 CGCCCCTTGCCTCTCAGGGCTGG - Intronic
1061795656 9:133084376-133084398 CGCCCCTTGCCTCTCAGGGCTGG - Intronic
1061826704 9:133262365-133262387 CGCCTCCCTCTTCTCTGAGTGGG - Intronic
1062169433 9:135126779-135126801 CGCCTCTGCCCTCTCAGGGGAGG + Intergenic
1062490310 9:136802035-136802057 TGCCTCCGGCCTCCCAGTGTTGG + Intronic
1185463159 X:341529-341551 CTCCTCCTGCCTCTCCGGGGAGG + Intronic
1185643150 X:1599487-1599509 CGCCGCCCGCATTTCAGGGGAGG - Intronic
1190082337 X:47366218-47366240 CGCCCCCCTCCTCCCTGGGTAGG + Intergenic
1190298720 X:49043479-49043501 CTCCTCCCTCCTCCCAGGGATGG + Exonic
1192988755 X:76428316-76428338 CGCTTGCCGCCTCTGAGGGCCGG + Exonic
1195114089 X:101678695-101678717 CACCTCCCACCTGTTAGGGTTGG + Intergenic
1195323240 X:103737974-103737996 CTCCTACCAACTCTCAGGGTTGG - Intergenic