ID: 926013298 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:9425167-9425189 |
| Sequence | GGCACATATGAAAGTGAGAG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 257 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 24, 4: 231} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 926013295_926013298 | 3 | Left | 926013295 | 2:9425141-9425163 | CCCAGGATGTTCTAGGCAGTGGA | 0: 1 1: 0 2: 3 3: 19 4: 239 |
||
| Right | 926013298 | 2:9425167-9425189 | GGCACATATGAAAGTGAGAGTGG | 0: 1 1: 0 2: 1 3: 24 4: 231 |
||||
| 926013296_926013298 | 2 | Left | 926013296 | 2:9425142-9425164 | CCAGGATGTTCTAGGCAGTGGAA | 0: 1 1: 1 2: 48 3: 99 4: 252 |
||
| Right | 926013298 | 2:9425167-9425189 | GGCACATATGAAAGTGAGAGTGG | 0: 1 1: 0 2: 1 3: 24 4: 231 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 926013298 | Original CRISPR | GGCACATATGAAAGTGAGAG TGG | Intronic | ||