ID: 926013298

View in Genome Browser
Species Human (GRCh38)
Location 2:9425167-9425189
Sequence GGCACATATGAAAGTGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926013295_926013298 3 Left 926013295 2:9425141-9425163 CCCAGGATGTTCTAGGCAGTGGA 0: 1
1: 0
2: 3
3: 19
4: 239
Right 926013298 2:9425167-9425189 GGCACATATGAAAGTGAGAGTGG 0: 1
1: 0
2: 1
3: 24
4: 231
926013296_926013298 2 Left 926013296 2:9425142-9425164 CCAGGATGTTCTAGGCAGTGGAA 0: 1
1: 1
2: 48
3: 99
4: 252
Right 926013298 2:9425167-9425189 GGCACATATGAAAGTGAGAGTGG 0: 1
1: 0
2: 1
3: 24
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926013298 Original CRISPR GGCACATATGAAAGTGAGAG TGG Intronic