ID: 926014581

View in Genome Browser
Species Human (GRCh38)
Location 2:9438377-9438399
Sequence CTGGCAACCCAATTTGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926014581_926014584 -1 Left 926014581 2:9438377-9438399 CCACCATCAAATTGGGTTGCCAG 0: 1
1: 0
2: 0
3: 3
4: 114
Right 926014584 2:9438399-9438421 GATTTAGCAAATAAAACTAGAGG 0: 2
1: 16
2: 160
3: 336
4: 558
926014581_926014585 19 Left 926014581 2:9438377-9438399 CCACCATCAAATTGGGTTGCCAG 0: 1
1: 0
2: 0
3: 3
4: 114
Right 926014585 2:9438419-9438441 AGGACAACTCATTAAATTTTAGG 0: 1
1: 0
2: 1
3: 18
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926014581 Original CRISPR CTGGCAACCCAATTTGATGG TGG (reversed) Intronic
900865611 1:5266665-5266687 CTGGCATCCCTGCTTGATGGTGG + Intergenic
903971070 1:27119235-27119257 CTGGCAACCCAGGGTGATGTCGG - Intronic
905652601 1:39666448-39666470 CTGGAAGCACAATCTGATGGAGG + Intronic
916419942 1:164627599-164627621 ATGGGAAGCCAATGTGATGGAGG + Intronic
917083377 1:171280150-171280172 CTGGCTCCCCAGTTTGGTGGGGG + Intronic
917243141 1:172971279-172971301 CTCGCAGCCCAATTTGTTTGAGG - Intergenic
917505470 1:175623435-175623457 TGGGCATCCCAATTTGTTGGAGG + Intronic
918157329 1:181861423-181861445 CTGGCACCCCAAGATGGTGGAGG - Intergenic
920167537 1:204046226-204046248 CTGATAACCCACTTTGAGGGGGG - Intergenic
920798581 1:209164442-209164464 ATGGAAACCCTATTGGATGGGGG - Intergenic
924899505 1:248382082-248382104 GTGGCCACACAATTTGGTGGTGG + Intergenic
1062908466 10:1195801-1195823 CTGGCATCCTAAGATGATGGTGG + Intronic
1065153135 10:22842666-22842688 CAGGGAACCCATTTTAATGGTGG + Intergenic
1070097668 10:73353802-73353824 CTGGTAACCCATTTTGATTTGGG + Intronic
1070166505 10:73902673-73902695 CTGGAAACCCAATTCTATGCAGG + Intergenic
1072536815 10:96370435-96370457 CTCGTCACCCCATTTGATGGAGG + Intronic
1077815028 11:5678640-5678662 CAGGTAACCCATTTTGATGCAGG - Intronic
1077938670 11:6817089-6817111 CTGCTGACCCATTTTGATGGAGG - Intergenic
1078131364 11:8616803-8616825 CTGGCAGCCCTTTTTGTTGGAGG - Exonic
1080844624 11:36015805-36015827 CTTGCAACCCAAGTGGGTGGAGG - Intronic
1084949773 11:72658231-72658253 CTCCCAGCCCAATCTGATGGGGG - Intronic
1086901833 11:92376222-92376244 CTGGCAGACCACTTTGCTGGGGG + Intronic
1087657975 11:100949250-100949272 CTGGTAACACAGTTTGAGGGAGG - Intronic
1087769542 11:102192908-102192930 CAGGCAAACAAATCTGATGGGGG + Intronic
1088532137 11:110821868-110821890 CTAGCAACTCAATTTGAAGAAGG + Intergenic
1088867820 11:113865574-113865596 GTGCCAACACCATTTGATGGGGG + Intronic
1090017330 11:123097854-123097876 CTGGAAGCCCCAGTTGATGGTGG + Exonic
1095995983 12:48085154-48085176 CTGCCACCCCAATTTCCTGGTGG + Intronic
1099863978 12:88255304-88255326 CTGGCAACCCAATTTATTTCTGG + Intergenic
1101882426 12:108634544-108634566 CTGGCCTCCCCATTGGATGGAGG - Intergenic
1102635471 12:114319791-114319813 CTGGCTCCACAATTTGATAGTGG + Intergenic
1107496245 13:40928409-40928431 CTAGGAACCCAGTTTGATGGAGG + Intergenic
1108620061 13:52173293-52173315 CTAGGAACCCAGTTTGATGGAGG + Intergenic
1113218705 13:108073037-108073059 GTGGCAACCCACATTGAGGGTGG + Intergenic
1114833924 14:26180431-26180453 CTGGCATCCCAATTTGTGAGTGG - Intergenic
1117547396 14:56804710-56804732 CTGGCAGCTCGAATTGATGGGGG + Intronic
1119991709 14:79205224-79205246 TTGGGAACCGAATTTTATGGTGG + Intronic
1122466257 14:101935540-101935562 CTGGAAACTCAATTTGAAGAAGG + Intergenic
1124063317 15:26316490-26316512 GTGGAAACCCAATGTCATGGGGG - Intergenic
1131853044 15:96563290-96563312 CTCACAAACCAATGTGATGGTGG + Intergenic
1133373091 16:5260873-5260895 CTCAGAACCCATTTTGATGGTGG - Intergenic
1138220273 16:55244415-55244437 CTGGCAACCCATTTTGCTACAGG - Intergenic
1139555701 16:67708565-67708587 CTGGCAAGCAAATTTAATGATGG + Intronic
1140162135 16:72507700-72507722 TTGGCAAGATAATTTGATGGGGG + Intergenic
1140414447 16:74763905-74763927 CAGGCAAGCAAATTTGAAGGTGG - Intronic
1140601187 16:76476884-76476906 CTTGCAACCCTATTTAATGAGGG + Intronic
1147746681 17:42699040-42699062 CTGCCCACCAAACTTGATGGGGG - Exonic
1151200537 17:72464674-72464696 CTGGGAACACAATTTGGTTGGGG - Intergenic
1153573330 18:6495360-6495382 CTAGCAGCCCCATTTGGTGGAGG + Intergenic
1156465271 18:37344823-37344845 CTGGCAGCCCAGCTTGCTGGTGG + Intronic
1158265637 18:55658060-55658082 CTTACAACCCAATTTGAATGGGG + Intronic
1159668122 18:71189186-71189208 CTGGCAGACTAATTTGTTGGGGG + Intergenic
1162612768 19:11768799-11768821 CTGGTCAGCCAATTGGATGGTGG + Intronic
1165901863 19:39173046-39173068 CTGGCATCCCATTTTCCTGGCGG - Exonic
926014581 2:9438377-9438399 CTGGCAACCCAATTTGATGGTGG - Intronic
929617656 2:43324724-43324746 CTGTCAAGCCACTTTGATGATGG + Intronic
929988741 2:46765652-46765674 ATGACAACCAAATTTGATGTGGG - Intergenic
930257238 2:49106303-49106325 CTGGTAGCCAAGTTTGATGGAGG + Intronic
930812299 2:55555323-55555345 GTGCCAAGACAATTTGATGGGGG - Intronic
931723644 2:65087054-65087076 CTGGCAACACATTTTGTTGTGGG - Exonic
936681284 2:114775199-114775221 CTGTTAACCCAACTTGATGCAGG + Intronic
936824044 2:116558756-116558778 TTGGAAACCCAAATTGAGGGGGG + Intergenic
937689043 2:124733564-124733586 GTAACAACCCAATTTGATTGAGG + Intronic
937955410 2:127419242-127419264 CTGTCAACCCCATTTCATAGAGG - Intronic
942386314 2:175447091-175447113 CTTGCAATGCAATTAGATGGGGG + Intergenic
942856588 2:180556028-180556050 CTGTCTACCCCTTTTGATGGGGG - Intergenic
943732086 2:191313077-191313099 CATGAAACACAATTTGATGGGGG + Intronic
943749868 2:191500299-191500321 CTGGCAAGCCAATTGCATTGAGG + Intergenic
947317878 2:228881649-228881671 CTGGAAACCAATTTTGATGTTGG - Intronic
1174170471 20:48614959-48614981 CAGGCAATCCAATCTGCTGGGGG + Intergenic
1174934436 20:54852165-54852187 TTGGCAACCCAATTGCATGCTGG - Intergenic
1175504738 20:59473548-59473570 CTGCCAAACCAATGTGATGGTGG - Intergenic
1177763508 21:25430247-25430269 CAGGCAACCCACAGTGATGGAGG - Intergenic
1179767702 21:43585454-43585476 CTCTCAACCCAAGGTGATGGTGG + Intronic
1180218158 21:46339673-46339695 GTGGCAACCCAGATTGAGGGTGG + Intronic
1180895967 22:19332374-19332396 TTGGCGACCAAGTTTGATGGAGG + Intronic
950335592 3:12190365-12190387 CTGGGAAACCAAGGTGATGGAGG - Intronic
954122495 3:48507701-48507723 CTGGCCACCAGCTTTGATGGAGG + Intergenic
955486969 3:59444924-59444946 CTGCCAAGACAATTTGAAGGTGG + Intergenic
956263689 3:67374004-67374026 CAGTCAACCCAATTTGGAGGAGG - Intronic
956377448 3:68630833-68630855 CTGGCTAACCAATTTGCTGCTGG - Intergenic
959580481 3:107977897-107977919 TGGGCAACCCAATTAGATGAGGG + Intergenic
961351663 3:126308178-126308200 CTGGCAACCCACACTGCTGGAGG + Intergenic
962618895 3:137157256-137157278 TTGACAACCCAATGTGATGAGGG + Intergenic
963043044 3:141083216-141083238 CTGGCCAGCTTATTTGATGGAGG + Intronic
965411538 3:168337822-168337844 CTGCCAAATCACTTTGATGGTGG - Intergenic
966216266 3:177506286-177506308 CTGACAACCCAAAGTGATAGTGG - Intergenic
972072026 4:35032769-35032791 CTTACAACCCAACTTGAAGGAGG + Intergenic
973038837 4:45445293-45445315 GTGCCCACCCAATTTGAGGGTGG - Intergenic
975967126 4:79986739-79986761 CTGGCAAAACACTCTGATGGGGG - Intronic
979772423 4:124544498-124544520 CTGGCAACTCCATTTTCTGGAGG - Intergenic
980421556 4:132566707-132566729 CTGGAGACCCAGTTTGGTGGGGG + Intergenic
984724663 4:183009354-183009376 CTGACATCCCACTTTGGTGGAGG + Intergenic
988098969 5:26654608-26654630 CTGTGACCTCAATTTGATGGTGG - Intergenic
1001874987 5:175192372-175192394 CTTGCAACCCCATTTTATAGTGG + Intergenic
1010377148 6:75184114-75184136 ATGGCAATCAAATTTGAAGGAGG + Exonic
1011327709 6:86168598-86168620 CTGGCAACACAATTTATTGTAGG - Intergenic
1012247368 6:96940499-96940521 GTGGCAACTGAATTTGATGTTGG + Intronic
1016270215 6:142279960-142279982 TTGGCAGCCCATTTTGATGAGGG + Intergenic
1016514648 6:144880626-144880648 CTTGCAAGTCAATTTGATGTAGG - Intergenic
1017798316 6:157868109-157868131 CTGGCAACCTAATCTGATTTAGG - Intronic
1017820944 6:158048695-158048717 CTGGCAAGCCAGTTTTATTGGGG + Intronic
1017886245 6:158601815-158601837 CTAGCATCCCCATTTTATGGAGG + Intronic
1018485074 6:164232812-164232834 CTGTAAACCCAGTTTGTTGGAGG + Intergenic
1031676120 7:124614652-124614674 CTGTCAACTCAATTGGATTGAGG + Intergenic
1032006378 7:128305240-128305262 CTGGCAACTCAAGTGGAGGGAGG - Exonic
1032419286 7:131764911-131764933 CTGTCACCCCAGCTTGATGGGGG + Intergenic
1033252671 7:139774777-139774799 CTCGCAAAGCAAGTTGATGGAGG + Intronic
1038702687 8:29863779-29863801 CCAGCAAACCCATTTGATGGGGG + Intergenic
1047021563 8:120780236-120780258 GAGGCAAGCCAATTTGGTGGTGG - Intronic
1053141947 9:35688072-35688094 TTGGAAACCCAAGTTGCTGGTGG - Intronic
1062573076 9:137194429-137194451 CTGGAAACCCCATTTGCTGCTGG - Intronic
1203441728 Un_GL000219v1:15787-15809 CTGACAGCCCAGTTTGATGCAGG + Intergenic
1203512538 Un_KI270741v1:134696-134718 CTGACAGCCCAGTTTGATGCAGG + Intergenic
1186714250 X:12233421-12233443 CTGGCAACCCTATATGTTTGGGG + Intronic
1194161420 X:90457587-90457609 GTGGCCACCCAAATTGAGGGTGG + Intergenic
1197189027 X:123624133-123624155 CGGGCAACTGGATTTGATGGTGG - Exonic
1201891569 Y:18948497-18948519 CGGGAACCCCAATTTGAAGGTGG - Intergenic