ID: 926014898

View in Genome Browser
Species Human (GRCh38)
Location 2:9442404-9442426
Sequence AAATATATGCAGAACTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926014898 Original CRISPR AAATATATGCAGAACTTGGG AGG Intronic
903265063 1:22153303-22153325 AAATTCATGGAGAACTGGGGTGG + Intergenic
904700275 1:32353775-32353797 ATATGGCTGCAGAACTTGGGGGG - Intronic
905721679 1:40208654-40208676 AAAAAAATGCAGAACTTAGCTGG + Intronic
906416955 1:45627405-45627427 AAATATTTTTAGAAGTTGGGGGG - Exonic
907198994 1:52709928-52709950 ATATAATTCCAGAACTTGGGAGG - Intergenic
908178446 1:61579512-61579534 AAATACACAAAGAACTTGGGAGG + Intergenic
908554547 1:65244796-65244818 CAATATATGAAGAACTTAGGAGG + Intergenic
908640906 1:66222250-66222272 AAATATAAGCAGAAGTTGTTGGG - Intronic
908899899 1:68944495-68944517 CAATATATTAAGAACTTGGTAGG - Intergenic
908951036 1:69563243-69563265 AAATACATTCATAACCTGGGAGG + Intergenic
909744202 1:79073183-79073205 AAATATTTTCAGAACTTGTCTGG - Intergenic
909797501 1:79760339-79760361 AAAGACATTCAGAACTTGAGGGG + Intergenic
909963707 1:81880973-81880995 AAATATAGGAAGAAATGGGGTGG - Intronic
911292275 1:96071544-96071566 AGTTAGATTCAGAACTTGGGAGG + Intergenic
911955258 1:104225552-104225574 AAATATATGCAGATCTTCTCTGG - Intergenic
913288326 1:117248530-117248552 AAACATATGCAGGACAAGGGTGG + Intergenic
913441527 1:118903386-118903408 AAATATTTGCTGAACTTTGAAGG - Intronic
914729434 1:150357683-150357705 AAAAATATGCAAAACTTAGCTGG - Intergenic
915361162 1:155287156-155287178 AGATCTCTGCAGAAATTGGGAGG - Exonic
915821822 1:159031845-159031867 AAATATTTGAAGAAATTAGGAGG + Intronic
915866924 1:159511159-159511181 TGATATATGCAAAACTTGGATGG + Intergenic
916340093 1:163723887-163723909 AAAGATGTGAAGAACTTGGCTGG + Intergenic
916591188 1:166192270-166192292 AAATATATACAGAAATTAGCTGG + Intergenic
916749043 1:167707786-167707808 AAGTAACTGCAGTACTTGGGAGG - Intergenic
916814782 1:168341122-168341144 AAATATATATATAAATTGGGAGG + Intergenic
917643418 1:177006263-177006285 AAATATATACAGAATTGAGGTGG + Intronic
918232556 1:182549424-182549446 AAATATATGCAGATATTTTGTGG + Intronic
918895648 1:190340651-190340673 AAATAAATTAAGAACTTGTGTGG - Intronic
919421543 1:197375616-197375638 AAACATAGGCAGGAATTGGGAGG - Intronic
919650569 1:200145014-200145036 AAAAATATTCAGAACTGGGCGGG + Intronic
922227495 1:223658262-223658284 ACATTTTAGCAGAACTTGGGAGG - Intronic
922362766 1:224838312-224838334 ATATATAGACAGAACTTGAGTGG - Intergenic
924393403 1:243589009-243589031 AAATATATACAAAACTCGGCTGG + Intronic
924601365 1:245492595-245492617 AAATTGATGCAAAACTTCGGTGG - Intronic
1063735903 10:8754067-8754089 AAATGCATGCAGAAATTGGAGGG + Intergenic
1065504685 10:26417649-26417671 CAATATATTCAGAACTCAGGTGG - Intergenic
1067221467 10:44347158-44347180 AAACATATGCAAAACATGGCGGG - Intergenic
1068628949 10:59280056-59280078 AAATATATGTTGAAGTTTGGAGG - Intronic
1069237102 10:66089887-66089909 AAAAATATGCAGAACTCGCTTGG - Intronic
1069535029 10:69246913-69246935 ATGTCTATGCAGAACTTGGCAGG + Intronic
1069537306 10:69264170-69264192 AAATCTATTCAGACATTGGGAGG - Intronic
1070488625 10:76954682-76954704 TAAGATATGCAGCAGTTGGGAGG - Intronic
1074096772 10:110320097-110320119 AAATATATTCAGACTTGGGGAGG + Intergenic
1074616210 10:115070885-115070907 AAATATATGCTGTATTTGGGGGG + Intergenic
1076442436 10:130489374-130489396 AATTATTTTCAGAACCTGGGAGG - Intergenic
1078480494 11:11671518-11671540 AAATTGAAGCAGCACTTGGGTGG + Intergenic
1079808720 11:24968148-24968170 AAACCTAGACAGAACTTGGGAGG - Intronic
1081550336 11:44105926-44105948 GAATCTATGCAGAGCTTGGTGGG + Intronic
1082204052 11:49409806-49409828 AAATGTATGTATAACTTTGGGGG + Intergenic
1086651042 11:89290721-89290743 AAATATATGTATAACTTTGGGGG - Intronic
1088009332 11:104980303-104980325 GAATCTATTTAGAACTTGGGAGG + Intergenic
1089031726 11:115337638-115337660 AAATATATGTATAACTTAGTTGG - Intronic
1089750231 11:120646398-120646420 AAACAGATGCAGAGCTTGTGCGG + Intronic
1090297120 11:125598553-125598575 AAATATAAACTGAATTTGGGAGG - Intronic
1090887642 11:130893233-130893255 TAATATTTGCAGAAATTTGGAGG - Intronic
1091006193 11:131955954-131955976 AATTATTTACAGAACTTGTGAGG + Intronic
1095102131 12:38196328-38196350 AAATATATGCAAACCTTGCCTGG - Intergenic
1095367631 12:41427049-41427071 AAACATTTGCAGAACTTGGATGG + Intronic
1096322357 12:50626257-50626279 TAATTTACACAGAACTTGGGTGG + Intronic
1098472149 12:70857782-70857804 GAATATATGCATAACTTAGAAGG + Intronic
1099297084 12:80841604-80841626 ACATATATGCAGAATCAGGGAGG - Intronic
1099927032 12:89031079-89031101 AAGTATATGCCTAATTTGGGTGG - Intergenic
1101154919 12:101918340-101918362 AAATAAAGGCAGAACTTTGGGGG - Intronic
1101658433 12:106745076-106745098 ACATATAGGAAGAATTTGGGCGG + Intronic
1104855605 12:131901020-131901042 AAAGATATACACAACTTCGGAGG - Intronic
1107117591 13:36763545-36763567 ACAGACATGCAGAACCTGGGTGG - Intergenic
1109797428 13:67334852-67334874 AAAGATATGTAGAACATGGTGGG + Intergenic
1110177138 13:72570302-72570324 ATATTTATGCAGTACTTGGAGGG - Intergenic
1110734540 13:78920761-78920783 AAATAAATGCAGAGCATGTGTGG + Intergenic
1111738568 13:92173784-92173806 AAATATTTGCAGAATGTGGAAGG + Intronic
1113451927 13:110416572-110416594 AAAAATAGGCAGCACATGGGTGG - Intronic
1114484747 14:23056008-23056030 GAATACATGCAGAGCCTGGGTGG - Intronic
1115994018 14:39176720-39176742 AAATACCAACAGAACTTGGGGGG - Intronic
1116033300 14:39598630-39598652 AAATCACTGCAAAACTTGGGGGG - Intergenic
1118061561 14:62143810-62143832 AAAAATGTTCAGAACTGGGGAGG - Intergenic
1118492753 14:66277551-66277573 ATATATACTCAGAAGTTGGGGGG - Intergenic
1121928099 14:97947587-97947609 AAACACAAGCAGAACTTGGCTGG - Intronic
1125426730 15:39556396-39556418 AAATATGTACTGAAGTTGGGTGG + Intergenic
1128699441 15:69793678-69793700 AAGAATAGGCAGAATTTGGGTGG - Intergenic
1130647992 15:85745281-85745303 AAATACATGCAAAACACGGGTGG - Exonic
1131894289 15:97008696-97008718 AAATATTTGTAGAGTTTGGGTGG + Intergenic
1132376668 15:101332623-101332645 AAATGTCTGCAGAAGCTGGGTGG + Intronic
1133928481 16:10212899-10212921 AAATATATACAGAAATTAGCTGG + Intergenic
1135159072 16:20077571-20077593 AAATATATACAGAATTTTAGAGG + Intergenic
1138817592 16:60220771-60220793 AAATATGTGCAGGACTTTTGGGG + Intergenic
1139945482 16:70638559-70638581 AAGCATATGCAGATATTGGGAGG - Intronic
1140280061 16:73545755-73545777 AAACAGAGGCAGAAATTGGGTGG + Intergenic
1147731693 17:42607839-42607861 AAATAAATGAAGAACGTGGTAGG + Intronic
1148359884 17:47003071-47003093 AAATATTTGTAGAAGTTGGGGGG - Intronic
1148510959 17:48169387-48169409 AGATATATGTGGAACATGGGCGG + Intronic
1150518375 17:65838175-65838197 AAATGTCTGCAGCAGTTGGGTGG - Intronic
1150875067 17:68961776-68961798 AAATGTATGCTGCACCTGGGAGG + Intergenic
1151320208 17:73348417-73348439 AACTTTGAGCAGAACTTGGGAGG + Intronic
1153400132 18:4675899-4675921 AAAATTATGCAGAAGTTTGGGGG - Intergenic
1153537858 18:6121951-6121973 ATGTATATGCAGAACTGGAGTGG - Intronic
1154407175 18:14103383-14103405 AAATGAATGCAGAAAATGGGGGG + Intronic
1155477283 18:26247544-26247566 AAATATACTCAAAACTTTGGGGG - Intronic
1155604299 18:27586067-27586089 AAATATATCCAGAACCTGCCGGG - Intergenic
1155705403 18:28804522-28804544 AAAAGTATGGAGAACTGGGGAGG - Intergenic
1156641873 18:39111355-39111377 AAAAATATTCAAAAATTGGGAGG + Intergenic
1157000488 18:43517350-43517372 AATTAAATGCAGAGCTTTGGGGG + Intergenic
1157080710 18:44522217-44522239 AAATATAAGCAGCATTTGGAAGG + Intergenic
1157322106 18:46642502-46642524 AAGTAGATGCAGACCTTGGGTGG + Intronic
1157954401 18:52081145-52081167 AAACATATGCAAAACTAGGAGGG + Intergenic
1158819811 18:61146440-61146462 AAATATATGCAGAATTATGTAGG + Intergenic
1164666960 19:30046489-30046511 AACTATATTCAGAACCTGGTGGG + Intergenic
1165315387 19:35052228-35052250 AAATCTGTGTAGTACTTGGGCGG + Intronic
1166195629 19:41203844-41203866 AAATATATGCAGAAAGGGAGGGG - Intronic
925957728 2:8984647-8984669 AAATAAATAAAGAACTAGGGGGG + Intronic
926014898 2:9442404-9442426 AAATATATGCAGAACTTGGGAGG + Intronic
928130829 2:28648910-28648932 AAATATCTGGAGAACCAGGGTGG - Intergenic
928292309 2:30050211-30050233 ACATATATGCAAAGCATGGGTGG + Intergenic
930357586 2:50341733-50341755 AAATATATGCAGCAACTTGGTGG + Intronic
930428175 2:51237966-51237988 AAATATAAGAAGAAATTGGTTGG - Intergenic
932956647 2:76358493-76358515 AAATATATCCAGGAATTGGGAGG - Intergenic
934050696 2:88208276-88208298 AACTAGAAGGAGAACTTGGGTGG + Intergenic
934478404 2:94609923-94609945 TAATCTTTGCAGAACTGGGGAGG + Intergenic
934690518 2:96355148-96355170 AAAAATAATCAGAACTTGGTTGG + Intronic
935593133 2:104858953-104858975 AAAAAGAAGCTGAACTTGGGGGG - Exonic
936877314 2:117206434-117206456 AAATATAGGCAGAAATTGAATGG + Intergenic
938050074 2:128161527-128161549 AAATATATGCAGAAGTAAAGAGG + Intronic
938840629 2:135158964-135158986 AAAAATTTGCAGAAGTTTGGGGG + Intronic
939658927 2:144863288-144863310 AAATATATGCAGAATGTGTTAGG - Intergenic
940787057 2:157992994-157993016 AAATTGGTTCAGAACTTGGGTGG - Intronic
941169191 2:162116987-162117009 AAATATATGCAGAGCATGTGTGG - Intergenic
941597023 2:167490140-167490162 AAATATATGAGTAACTTTGGAGG - Intergenic
942621943 2:177853621-177853643 ATATATATGCAGGACTTGTTGGG - Intronic
943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG + Intronic
944591784 2:201224587-201224609 ATATGTATGCAGAAGTGGGGAGG - Intronic
944759725 2:202802034-202802056 AAATATCTGAAGTCCTTGGGGGG - Intronic
944925506 2:204459954-204459976 AAATATATTCTACACTTGGGGGG - Intergenic
947775433 2:232705153-232705175 AAAAATATCCAGAAGTTGGCCGG - Intronic
1169515154 20:6308963-6308985 AAATATACCCAGAAATTGGATGG + Intergenic
1169780360 20:9302676-9302698 CACTATATGAAGAACTTTGGAGG - Intronic
1170942307 20:20858639-20858661 CAATATGTGAATAACTTGGGTGG - Intergenic
1171817840 20:29804270-29804292 AAATATATGCAAATCTTGCCTGG + Intergenic
1173279451 20:41615703-41615725 AAAGAGATTCAGAACATGGGTGG + Intronic
1177084807 21:16690192-16690214 AAATGTCTGCAGCACTGGGGAGG - Intergenic
1178106831 21:29328842-29328864 TACAATATGGAGAACTTGGGAGG - Intronic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
951365861 3:21781745-21781767 AAATATAAGCAGATATTTGGAGG + Intronic
952644910 3:35643932-35643954 AAATATATTCAGAACTTTCCAGG - Intronic
953078602 3:39594308-39594330 AAATATATACAAAAATTAGGCGG - Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956675631 3:71729403-71729425 CAATAAAGGCAGAACATGGGAGG + Intronic
958419098 3:93911537-93911559 AAATATTTGCAGAGTTTGGTTGG + Intronic
959485547 3:106924684-106924706 AAATATATGCATCAGGTGGGAGG + Intergenic
959560892 3:107779469-107779491 AGAGAGATGAAGAACTTGGGTGG + Intronic
962321216 3:134392108-134392130 AAATATATATAGAACTAGGCTGG - Intergenic
963017244 3:140837579-140837601 AAAGATATGGAGAAATTGGCCGG + Intergenic
965859132 3:173125686-173125708 AAATACATACACAACTTGGTAGG - Intronic
970328478 4:14953957-14953979 AAATATTTTCAAAACTTGGAGGG - Intergenic
971246862 4:24937179-24937201 AAAAATCTGGAGAACTTGGCTGG + Intronic
971844162 4:31897038-31897060 AAATTTATGAACAACTTGGCTGG - Intergenic
975380060 4:73689802-73689824 AAGTCTAGGCAGAACTTGGTAGG + Intergenic
977981311 4:103326106-103326128 AAAAATATGTAGAATTTTGGGGG + Intergenic
979947853 4:126856655-126856677 ACATATATGAAGAACTCTGGTGG + Intergenic
981039007 4:140203793-140203815 AAATACTTGCTGAACTTGGCCGG - Intergenic
981082151 4:140646122-140646144 AAATATTTGCTGAACTTAGGGGG + Intronic
981724559 4:147833986-147834008 AAAGATAGGCAGAACGTGGGAGG - Intronic
981786149 4:148481720-148481742 AAGTAAATGCAGAACCTCGGAGG - Intergenic
982224768 4:153155402-153155424 AAGAATATGCAGAAATTGGAGGG + Intronic
983914005 4:173271404-173271426 AAATATATGTATTACTTGGCTGG - Intronic
984326948 4:178267439-178267461 TAAAATATGCAGATCTTGGTAGG - Intergenic
987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG + Intronic
990517413 5:56543077-56543099 TCATATAAGCAGAACCTGGGAGG - Intronic
992560465 5:77947480-77947502 AAATATAAGCAAAAATTGGGTGG + Intergenic
994112482 5:96022515-96022537 AACTACATTCAGTACTTGGGAGG - Intergenic
994579621 5:101623746-101623768 AAATATATGCAGGATTTGTATGG - Intergenic
994858641 5:105159217-105159239 CAATATATAAAGAACTTGGAAGG + Intergenic
995132410 5:108644359-108644381 TAGTAAGTGCAGAACTTGGGGGG - Intergenic
995949120 5:117688425-117688447 AAATATTAGCTGAACGTGGGTGG - Intergenic
996614650 5:125426364-125426386 AAAAATATGAAGAAGCTGGGAGG + Intergenic
999064125 5:148667217-148667239 AAATATCTGAAGAGTTTGGGAGG + Intronic
1000155172 5:158543600-158543622 AGATATATCCAGAAATTGTGAGG - Intergenic
1000816223 5:165925813-165925835 AAATATATGAAGTACTTCAGTGG + Intergenic
1001017839 5:168157584-168157606 AAAATTAGGCAGAACTTGGTTGG + Intronic
1001681293 5:173558974-173558996 AAATATAAGGAGAAAGTGGGGGG - Intergenic
1004354908 6:14922458-14922480 AAATATCTGCAGCATTTAGGTGG - Intergenic
1004708461 6:18147163-18147185 AAATAAATGCATATCTTGGCAGG + Intronic
1005514723 6:26543074-26543096 AAATATATGCAGAATATTTGGGG + Intronic
1008628512 6:53341902-53341924 GAATCTATGTAGAACTTGGAAGG - Intronic
1010911215 6:81559482-81559504 AAATATTTGAAGAACTTAGGAGG + Intronic
1011740124 6:90351106-90351128 TGATGTATGCAGAACTTTGGGGG - Intergenic
1013554676 6:111243985-111244007 AAATATATGGAAATTTTGGGGGG - Intergenic
1019244406 6:170698420-170698442 AAATGTATCCTGAACTTGGCCGG + Intergenic
1020049962 7:5074956-5074978 AATTATATGCAGTATTTGGCAGG - Intergenic
1022003607 7:26247636-26247658 ACATATATGCAAATCTTGGCCGG + Intergenic
1022351868 7:29573721-29573743 ATATATAAACAGAACTTGAGTGG + Intergenic
1022632113 7:32095001-32095023 AAAGATATGCAGATCTTAGCAGG - Intronic
1023180030 7:37472963-37472985 AAATATTGGCAGAATTTTGGGGG - Intergenic
1023444968 7:40222011-40222033 AAATATTTGCAGAACTGCAGTGG - Intronic
1023644916 7:42300975-42300997 AAATGTTTGCAGAATTTGTGGGG + Intergenic
1024905606 7:54375518-54375540 AAATATATCCGGAATTTGGGAGG - Intergenic
1026250403 7:68665088-68665110 AAATAAATGCACAAGCTGGGAGG - Intergenic
1027541452 7:79471912-79471934 AAATGTGAGCAGCACTTGGGAGG + Intergenic
1027601876 7:80249322-80249344 AAATACATCCTGAAATTGGGTGG - Intergenic
1028728537 7:94117608-94117630 ATATATATGAAGAAATTGGGTGG - Intergenic
1030229941 7:107197181-107197203 TAATATATGGAGAACTTGACTGG - Intronic
1033425053 7:141236425-141236447 AGATAGATGCAGCCCTTGGGAGG + Intronic
1035503719 8:109752-109774 AAATGTATCCTGAACTTGGCCGG - Intergenic
1037182022 8:16018651-16018673 AAATATATGCATAACTTCTGAGG + Intergenic
1037718328 8:21418933-21418955 AAACATAATCAGAACTTGGTGGG - Intergenic
1038449733 8:27632491-27632513 ACATATATGCAGAAAATGGCAGG - Intergenic
1041995103 8:64045574-64045596 AAATAAATACACAACTTGAGGGG - Intergenic
1042450546 8:68940379-68940401 AAAGATAGGCAGAACTTTTGGGG + Intergenic
1042577672 8:70238842-70238864 AAAATTATACAGAACTTAGGTGG + Intronic
1050722236 9:8603764-8603786 AAATATTTTCAGGACTTTGGAGG + Intronic
1051638702 9:19204537-19204559 AAAAATATACAGAAATTAGGCGG - Intergenic
1051788518 9:20773202-20773224 AAATATATGCTAAAGGTGGGGGG - Intronic
1053004483 9:34594991-34595013 AAATATATGCACAGCTTTAGTGG - Intergenic
1053929647 9:43104496-43104518 TAATCTTTGCAGAACTGGGGAGG - Intergenic
1054284068 9:63148777-63148799 TAATCTTTGCAGAACTGGGGAGG + Intergenic
1054292734 9:63311704-63311726 TAATCTTTGCAGAACTGGGGAGG - Intergenic
1054390752 9:64616179-64616201 TAATCTTTGCAGAACTGGGGAGG - Intergenic
1054911484 9:70459165-70459187 AATTATATGCCCAACTTGAGAGG - Intergenic
1058299072 9:103347081-103347103 GATTATATTCTGAACTTGGGTGG + Intergenic
1059101154 9:111472792-111472814 AAAAACATGAAGATCTTGGGGGG + Intronic
1059623428 9:116034645-116034667 AAAAAAATGCAGAATTTGGAGGG - Intergenic
1060631269 9:125161234-125161256 AAATAGATACAGAATTTGGGTGG - Intronic
1203604594 Un_KI270748v1:47646-47668 AAATGTATCCTGAACTTGGCCGG + Intergenic
1185829711 X:3288966-3288988 ATATGTATGTAGAATTTGGGTGG + Intergenic
1185885105 X:3775559-3775581 AAATAGATGGAGTACTTTGGCGG - Intergenic
1186707587 X:12158103-12158125 GAATACAGGCAGAATTTGGGAGG - Intronic
1186947851 X:14589361-14589383 AAATATATGCATATTTTGGCAGG + Intronic
1187156217 X:16722558-16722580 AAATATATGCAGAACAAATGGGG - Intronic
1187241301 X:17516176-17516198 AAATATATACAGAACTTCAAAGG - Intronic
1188294754 X:28433636-28433658 ATGTAAATGCAGAAATTGGGTGG - Intergenic
1190931691 X:54954145-54954167 ATATAAAACCAGAACTTGGGAGG - Intronic
1191085980 X:56567397-56567419 AAATATATTGAGAATTTGGTTGG + Exonic
1192553552 X:72072172-72072194 AAATATATACAGAACTTGAAAGG - Intergenic
1192796980 X:74432064-74432086 AAATATTTACAGCACTTGGCAGG + Intronic
1194038652 X:88913320-88913342 AAATATATTCTGCATTTGGGGGG - Intergenic
1195575659 X:106447262-106447284 AAATATATGCAATACTCAGGGGG + Intergenic
1196117254 X:112011188-112011210 ACATATAAGGAGAAATTGGGGGG - Intronic
1199282326 X:146016383-146016405 AAATATAGGAAGTACTTGTGTGG - Intergenic
1199424068 X:147681119-147681141 AAATAAATGCAGAACTGGGATGG + Intergenic
1201248287 Y:12028991-12029013 AAATGTGTGTAGAATTTGGGTGG - Intergenic