ID: 926016502

View in Genome Browser
Species Human (GRCh38)
Location 2:9457571-9457593
Sequence AATCAACCATGTAATTCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926016502_926016504 11 Left 926016502 2:9457571-9457593 CCAAAGGAATTACATGGTTGATT 0: 1
1: 0
2: 1
3: 11
4: 165
Right 926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926016502 Original CRISPR AATCAACCATGTAATTCCTT TGG (reversed) Intronic
906918652 1:50039422-50039444 AATCTACAATTTATTTCCTTAGG + Intergenic
908231648 1:62111483-62111505 AATAAACCCTGTAAATCATTTGG - Intronic
908424989 1:63998352-63998374 AAACAACCATGTAATTTAATAGG - Intronic
908533328 1:65054130-65054152 AATAAAACATGTGATCCCTTAGG + Intergenic
909821988 1:80076848-80076870 AATCATATATGTAATTTCTTTGG - Intergenic
910697708 1:90038721-90038743 AAATAAAAATGTAATTCCTTGGG + Intergenic
914416799 1:147491448-147491470 AAGCAAGCATGTTATTTCTTAGG - Intergenic
917334097 1:173910807-173910829 AATCACCGATGTCATTCCCTCGG - Exonic
921453396 1:215337440-215337462 AAGCAACCATTGTATTCCTTTGG - Intergenic
924747638 1:246851953-246851975 CATAAACCATGAAATTCCTAAGG + Intronic
1068798618 10:61113811-61113833 AATCAACTATAGAATTTCTTGGG + Intergenic
1069124920 10:64618605-64618627 ACTCCACTATGTTATTCCTTTGG - Intergenic
1071160637 10:82741562-82741584 AATAATCCATGTAAAGCCTTTGG - Intronic
1071430780 10:85604865-85604887 AATAAACCATAGACTTCCTTGGG - Intronic
1074001465 10:109377859-109377881 AATGAAACATGTAATTGATTTGG - Intergenic
1074615036 10:115059248-115059270 AAACAATCACGTAATTCATTCGG + Intergenic
1074903810 10:117842631-117842653 GAACAACAATGTCATTCCTTAGG - Intergenic
1078283745 11:9930361-9930383 AATCAAATATGTAATTTTTTTGG - Intronic
1079273472 11:19011466-19011488 AATCAACAATGTGCTCCCTTCGG - Intergenic
1082257451 11:50047337-50047359 AATCAACTAGGGAATTGCTTAGG - Intergenic
1086825979 11:91497278-91497300 AATCAACTATTGTATTCCTTTGG - Intergenic
1087871420 11:103297750-103297772 AATCTACCATCAAATTCTTTTGG + Intronic
1090731911 11:129579766-129579788 AATTAATCATGGAATTCCTCAGG - Intergenic
1092803724 12:12199079-12199101 AGTCATCCATGTTGTTCCTTTGG - Intronic
1093937849 12:25020083-25020105 AATGATCAATGTAATTTCTTAGG + Intergenic
1097466896 12:59937554-59937576 AATCAAGCATGTAATAACTTGGG - Intergenic
1098502067 12:71204774-71204796 AAACAACCATGAAATTCATATGG + Intronic
1100130734 12:91489876-91489898 AATCAACCAGGTAATATGTTAGG + Intergenic
1100913833 12:99395040-99395062 ACTCCACCATGAAATTCCATTGG + Intronic
1102799139 12:115716357-115716379 AAGCAAACATGGAATGCCTTGGG + Intergenic
1105733742 13:23246472-23246494 ATGCAACCCTGAAATTCCTTGGG - Intronic
1105839628 13:24242676-24242698 AATGTAACATGTTATTCCTTTGG + Intronic
1106208062 13:27617961-27617983 AATTATGCATGTAATGCCTTTGG - Intronic
1108485194 13:50916809-50916831 AATCAAACATGAACTTCTTTGGG + Intronic
1109682126 13:65765786-65765808 AACCCTCCATGTAATTTCTTTGG + Intergenic
1111432504 13:88162117-88162139 AATTAACCATGCATTTCCTAGGG - Intergenic
1111666870 13:91280597-91280619 AATTAACTATGTAATTTATTAGG + Intergenic
1113374965 13:109756661-109756683 AATGACCCCTGTAACTCCTTAGG + Intronic
1113532097 13:111035082-111035104 AAACATCTATGTAACTCCTTAGG - Intergenic
1114051901 14:18927315-18927337 AATCATCCATCTACTTCCTAAGG - Intergenic
1114110657 14:19474606-19474628 AATCATCCATCTACTTCCTAAGG + Intergenic
1115375432 14:32670340-32670362 AATCAACCCTGGAAGTCCTTGGG + Intronic
1116349356 14:43839876-43839898 AATAAACCATCTATTTCTTTTGG + Intergenic
1118230978 14:63949619-63949641 AATGACCCAAGTCATTCCTTAGG + Intronic
1118441513 14:65816224-65816246 AATCTACCATGGATTTCCTTGGG + Intergenic
1120767528 14:88343187-88343209 AATCAAACATCACATTCCTTAGG - Intergenic
1127009477 15:54606838-54606860 ATTCATCCATGTAATTCCTATGG - Intronic
1127998851 15:64172160-64172182 AATCAAGCAGCTATTTCCTTTGG - Intronic
1128467623 15:67926199-67926221 AACCAACCATTTAAATTCTTTGG - Intergenic
1130385263 15:83405824-83405846 AATCAAACATGTAACTAATTTGG - Intergenic
1131877864 15:96829882-96829904 AACCCACCATGTAATTCTTGTGG + Intergenic
1131950877 15:97680717-97680739 TTTGAACCATGTTATTCCTTAGG - Intergenic
1133754207 16:8750463-8750485 CATCAACCAGGTAATTGCCTCGG - Exonic
1136693997 16:32059504-32059526 AATCAACGTTGTAAATACTTCGG + Intergenic
1136794491 16:33002753-33002775 AATCAACGTTGTAAATACTTTGG + Intergenic
1136875419 16:33851630-33851652 AATCAACGTTGTAAATACTTCGG - Intergenic
1140759456 16:78098175-78098197 AATGAATGATGTGATTCCTTAGG - Intergenic
1203096754 16_KI270728v1_random:1264420-1264442 AATCAACGTTGTAAATACTTCGG + Intergenic
1145728985 17:27158276-27158298 AATAAACCATGAAATTCCTAAGG - Intergenic
1151529072 17:74692777-74692799 AGTCAATCCTGAAATTCCTTAGG + Intronic
1155625172 18:27826153-27826175 AAACAACCCTGCAATTTCTTTGG - Intergenic
1155839233 18:30626895-30626917 GATTAAACATGTAATTTCTTTGG - Intergenic
1157020341 18:43773815-43773837 AAACAAACATGAATTTCCTTTGG - Intergenic
1159098580 18:63934742-63934764 ATTCACCTATGTAATTCCTAGGG + Intronic
1162109622 19:8393119-8393141 AATCAACAGTGTCATTCCTGGGG - Intronic
926016502 2:9457571-9457593 AATCAACCATGTAATTCCTTTGG - Intronic
926673811 2:15602342-15602364 AATTAACCATTTCATTCCCTGGG - Intronic
927108155 2:19845153-19845175 AATAAACCATATGATTCTTTCGG + Intergenic
927315063 2:21672084-21672106 GATCAAACCTATAATTCCTTGGG - Intergenic
929038595 2:37721390-37721412 AACCAACCATGTGCCTCCTTTGG + Intronic
931008105 2:57875977-57875999 AATTCACCATGTTATTCCTATGG - Intergenic
932967767 2:76497991-76498013 AATCAAACAAGGAATTCCCTAGG + Intergenic
933558778 2:83865726-83865748 GATCCACCTTGGAATTCCTTTGG + Intergenic
935014372 2:99166152-99166174 ACTTAACCATGTAATCACTTAGG + Intronic
936635865 2:114257187-114257209 CATCAACCTTGTAATCCCATTGG + Intergenic
939400674 2:141689071-141689093 ATTCAGCCAGGAAATTCCTTAGG - Intronic
939611740 2:144319455-144319477 ATTCCATAATGTAATTCCTTTGG - Intronic
940221449 2:151356133-151356155 AATAAACCATGATATTTCTTTGG - Intergenic
941252416 2:163182465-163182487 AGTCAGTCATTTAATTCCTTGGG - Intergenic
942518746 2:176780851-176780873 AATCCACCATCTAATTGTTTTGG - Intergenic
943201061 2:184824725-184824747 ATTCAACCCTGTAATACCATAGG - Intronic
943404709 2:187465758-187465780 AAACAACCATTTCATTCATTTGG - Exonic
945724926 2:213464102-213464124 GATTAACCATGTAAGTTCTTTGG - Intronic
946135226 2:217641034-217641056 ACACAGCCATGTGATTCCTTTGG - Intronic
946786419 2:223248847-223248869 AATAGACCATGTTATTCATTGGG - Intergenic
947173215 2:227333878-227333900 AATCAATCAGGGAATTGCTTGGG - Intronic
1168899444 20:1349712-1349734 AATCAAGAAAGTAATTCCATTGG - Intronic
1169689074 20:8309939-8309961 AATCAACCATATCAGTACTTAGG - Intronic
1176134693 20:63517166-63517188 AAACAACCATGTCAGTGCTTTGG - Intergenic
1180470375 22:15649691-15649713 AATCATCCATCTACTTCCTAAGG - Intergenic
1183045234 22:35214133-35214155 AACCAACCTTGGACTTCCTTGGG - Intergenic
1183183487 22:36277782-36277804 AATGAACCCTGAAATTGCTTTGG + Intergenic
1184312169 22:43653345-43653367 AATCAACCATGTATCTTATTGGG - Intronic
953693695 3:45141303-45141325 AAACAACCATGTAAATGGTTTGG + Intronic
954012065 3:47649919-47649941 AGTCCACCATGTATTTCCTAAGG - Intronic
956195368 3:66649085-66649107 CATCAACCCCGTAAGTCCTTTGG - Intergenic
957851229 3:85809971-85809993 AATGTACCATTTAATTCCTAAGG - Intronic
959212978 3:103412609-103412631 GAAAAACCATGTAATTCTTTTGG + Intergenic
960055164 3:113271851-113271873 AATCACCTATGTACTTCCTCAGG - Intronic
963564751 3:146915196-146915218 AACCATTCATGTAATTTCTTGGG + Intergenic
964489524 3:157220453-157220475 ATTCAACCATATGATCCCTTTGG - Intergenic
965067220 3:163865382-163865404 AATCAACTATGTAAATGCTTAGG - Intergenic
965646862 3:170892809-170892831 ATGCAACCATGTGATTACTTTGG - Exonic
966580040 3:181551005-181551027 AATCTACTAAGTATTTCCTTTGG + Intergenic
967720365 3:192809537-192809559 AATAAACAATGTAATACCTTGGG + Intronic
969061802 4:4441747-4441769 AATCAACTATGAAATTCATCTGG + Intronic
971512177 4:27440424-27440446 GATCTACCATCTCATTCCTTTGG - Intergenic
971881528 4:32381007-32381029 AATGGATCATTTAATTCCTTAGG + Intergenic
974472090 4:62331563-62331585 AATCAAGCATGAATTTTCTTGGG + Intergenic
975020757 4:69485347-69485369 AATCTACCATGGAATCCCTATGG - Exonic
975464019 4:74688803-74688825 TCACCACCATGTAATTCCTTAGG + Intergenic
976004198 4:80408894-80408916 ACTTAACCATTTTATTCCTTAGG - Intronic
978871702 4:113586143-113586165 AAGCTAGCATGTAATTCCCTTGG + Intronic
979171035 4:117601388-117601410 AATCACCCAAGCAATTTCTTAGG - Intergenic
979391350 4:120131430-120131452 ATTTAACCATGTAATTTCTCTGG + Intergenic
982436924 4:155390415-155390437 TATTAACCATTTAATCCCTTAGG + Intergenic
983481750 4:168283029-168283051 AATCAATCATTTAAATACTTTGG + Intronic
986399301 5:7364581-7364603 AATCAAGCAGGGAATTGCTTAGG + Intergenic
986815109 5:11400633-11400655 AATCAACTTTGTAGTTCCCTTGG - Intronic
986930605 5:12815754-12815776 TATCAACCATCTATTTCCTTGGG - Intergenic
988639344 5:33023973-33023995 TATCAACCCTCTCATTCCTTAGG - Intergenic
988695877 5:33622236-33622258 ACTTAACCTTGTAATCCCTTAGG - Intronic
990076908 5:51857280-51857302 AATCAACCATTTAATTACTTAGG + Intergenic
990257252 5:53983710-53983732 ACTCAACCATGTACTGCCGTAGG + Intronic
991166459 5:63569237-63569259 GATTAAACATGTAATTTCTTTGG + Intergenic
995293938 5:110496032-110496054 ATTCAATCCTGTAATTTCTTGGG + Intronic
995951698 5:117721971-117721993 CTTGAACCATGTAATTCCTCTGG + Intergenic
996353202 5:122568523-122568545 AATCAAACATGTTACTCATTTGG - Intergenic
996903373 5:128570038-128570060 AATCAACTGAGAAATTCCTTTGG - Intronic
1000491870 5:161924055-161924077 AATCACCATTGTAATTCCATGGG - Intergenic
1001361955 5:171095538-171095560 CATCAACAATGGAGTTCCTTTGG - Intronic
1005209931 6:23448902-23448924 AAGCAAACATGAAATCCCTTTGG - Intergenic
1006233818 6:32609621-32609643 AATCAACCAGGAAATTATTTTGG + Intergenic
1008139431 6:47814913-47814935 AATCAAACAAGTAATGACTTGGG + Intronic
1008563593 6:52745977-52745999 AGTAAACCATGTATGTCCTTAGG - Intergenic
1011821505 6:91258131-91258153 AATCTACCCTTTAATTTCTTAGG + Intergenic
1012829199 6:104185183-104185205 AATCAACCATCTATTTTCTCAGG + Intergenic
1017221748 6:151973488-151973510 AATCCGCCATGTAATTCCTCAGG + Intronic
1019622460 7:1999278-1999300 TATCAACCATGTTTTTCTTTAGG - Intronic
1020510177 7:9046708-9046730 ATAAAACCATGTAATTCATTTGG + Intergenic
1020870200 7:13620116-13620138 AAACCACCATGTCATTTCTTGGG - Intergenic
1021061099 7:16113464-16113486 AATCCACCTTGAAATTCGTTAGG - Intronic
1021623785 7:22572954-22572976 AAGCGAGCATGTGATTCCTTGGG - Intronic
1025294394 7:57763978-57764000 AATAAACCATGAAATCCCTGAGG + Intergenic
1031563905 7:123270865-123270887 AACCAACCATATGATTACTTGGG + Intergenic
1033046025 7:137962703-137962725 AAACATACATGTAATTTCTTAGG - Intronic
1033447203 7:141433691-141433713 AATAAATTATGTAATTTCTTTGG + Intronic
1038816173 8:30906661-30906683 AAGCAGGCATGTAATACCTTAGG + Intergenic
1039138701 8:34357928-34357950 AATCACACCTGTAATCCCTTTGG - Intergenic
1041840397 8:62263761-62263783 ATTCAACGATTTTATTCCTTAGG - Intronic
1042738800 8:72019762-72019784 AATTACCCATGGAATTTCTTTGG - Intronic
1042929269 8:73997190-73997212 CATCATCCACCTAATTCCTTAGG + Intronic
1043440505 8:80272916-80272938 AATCAGCCAAGTAATTTTTTTGG - Intergenic
1044652378 8:94510042-94510064 CATAAAACATTTAATTCCTTGGG + Intronic
1045652971 8:104358892-104358914 CATCACCCATGAAGTTCCTTAGG - Intronic
1047105657 8:121727725-121727747 AATCATCCCTGAAATACCTTTGG + Intergenic
1049926101 9:408943-408965 AATTAACAGTGTAACTCCTTTGG + Intronic
1050858730 9:10396367-10396389 AATAGACCATGTAATTCTTCAGG + Intronic
1052095926 9:24384077-24384099 GATCATTCATCTAATTCCTTTGG + Intergenic
1055522166 9:77092590-77092612 AATTAACAGTGTGATTCCTTGGG + Intergenic
1059941413 9:119363442-119363464 AATCAGCCATGTAATTTTGTGGG - Intronic
1186635414 X:11398877-11398899 CATCAAAAATGTAATTCCTCTGG - Intronic
1187400518 X:18955789-18955811 AGTCAAATATTTAATTCCTTAGG - Intronic
1188321453 X:28743124-28743146 AATTCACCATTTAATTCCTTGGG - Intronic
1189358082 X:40326796-40326818 AATCACCTATCTAATTCCTTTGG + Intergenic
1192701154 X:73475293-73475315 AGTCATCCATGTTGTTCCTTAGG + Intergenic
1193599447 X:83491556-83491578 CAACCCCCATGTAATTCCTTAGG - Intergenic
1196424155 X:115552701-115552723 AAGTAACCAAGAAATTCCTTAGG - Intergenic
1199738077 X:150704142-150704164 TCACAACCATGTCATTCCTTGGG - Intronic
1200697423 Y:6373331-6373353 AATAAACCATGGAATCCCTAAGG - Intergenic
1200706509 Y:6447426-6447448 AATAAACCATGAAATCCCTAAGG - Intergenic
1200916611 Y:8576659-8576681 AATAAACCATGAAATCCCTAAGG + Intergenic
1200938376 Y:8758234-8758256 AATAAACCATGAAATCCCTGAGG - Intergenic
1200940291 Y:8773606-8773628 AATGAACCATGAAATCCCTAAGG - Intergenic
1200965081 Y:9028205-9028227 AATAAACCACGAAATTCCTAAGG - Intergenic
1201027603 Y:9717282-9717304 AATAAACCATGAAATCCCTAAGG + Intergenic
1201036690 Y:9791368-9791390 AATAAACCATGGAATCCCTAAGG + Intergenic
1202148028 Y:21820569-21820591 AATAAACCACGAAATTCCTAAGG + Intergenic