ID: 926016504

View in Genome Browser
Species Human (GRCh38)
Location 2:9457605-9457627
Sequence GCACCTATTAAGTTTAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926016502_926016504 11 Left 926016502 2:9457571-9457593 CCAAAGGAATTACATGGTTGATT 0: 1
1: 0
2: 1
3: 11
4: 165
Right 926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926016504 Original CRISPR GCACCTATTAAGTTTAAAGA AGG Intronic
901430727 1:9212876-9212898 GCAACTGTTAAGGTTAAGGATGG - Intergenic
903087680 1:20877520-20877542 GCACCTACTAAGTTGCAATATGG - Intronic
906629034 1:47349634-47349656 GCACCTATAAAGTTGAGAAAAGG + Intronic
913428930 1:118767327-118767349 GCACCCAATACGTTTAAAGGAGG - Intergenic
917118752 1:171627531-171627553 GCACTTTTTACTTTTAAAGAAGG - Intergenic
921565051 1:216706740-216706762 GCATCAGTTAAGTTTATAGAAGG - Intronic
1063745307 10:8872766-8872788 GAACTTCTTAAGTTTAAATATGG - Intergenic
1063850038 10:10177612-10177634 GAATCTATTAAGTGGAAAGAAGG - Intergenic
1064710401 10:18118173-18118195 TTACCTATTAAGTTATAAGATGG + Intergenic
1068020774 10:51581062-51581084 GCATTTATTAAGTTTAGTGAGGG + Intronic
1069328653 10:67263511-67263533 GCACCTATTCATTATAAAAAAGG + Intronic
1072712676 10:97727346-97727368 GCATCTATTCATTTTAAAAATGG + Intergenic
1080726792 11:34906061-34906083 GCCCCTATTATATGTAAAGAAGG + Intronic
1081227751 11:40545632-40545654 GCACATATTAAGTATAAACAAGG + Intronic
1081506301 11:43720732-43720754 GCACCTAGTAAGTTTAAACTTGG + Intronic
1082150534 11:48733773-48733795 TCACCTATAAACTATAAAGAAGG + Intergenic
1082599518 11:55132500-55132522 TCACCTATAAACTATAAAGAAGG + Intergenic
1083372119 11:62190403-62190425 TCACCTATTAAGGTTAAGGTTGG + Intronic
1086582619 11:88416717-88416739 GCACAGATTAAGCTTAAAGCAGG - Intergenic
1092278996 12:7085692-7085714 GAACCTAGTAGGTTTGAAGAAGG - Intronic
1092470846 12:8779262-8779284 TCACCTAATAAGTTTGAATATGG - Intronic
1096569476 12:52513227-52513249 GATCCTATTAAATTTAAACAAGG + Intergenic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1099367543 12:81787124-81787146 ACACATATTAAGAATAAAGATGG - Intergenic
1100211000 12:92398724-92398746 ACACCCATCAAGTTCAAAGAGGG + Intergenic
1100749448 12:97680944-97680966 GGACTTGTTAAGATTAAAGAAGG - Intergenic
1101351330 12:103931905-103931927 ACACCGAGTAAGTTTAAAAATGG + Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1103967826 12:124651439-124651461 GAAGCTATTAAGTTTTAAGCAGG - Intergenic
1105035136 12:132913874-132913896 TCATCTATTAAGTTTGAATATGG + Intronic
1105788897 13:23777924-23777946 GGACATACTAAGTTTTAAGAGGG + Intronic
1108479558 13:50854731-50854753 ACACCTCTTAAGTCTAAACATGG - Intergenic
1109853133 13:68093837-68093859 GCACCCATCATGATTAAAGATGG + Intergenic
1112170740 13:96969475-96969497 GCCCCTATTACATGTAAAGAAGG + Intergenic
1116363200 14:44027699-44027721 GCAATCATTAAGTTTAAATAAGG - Intergenic
1118054500 14:62065541-62065563 GCAATTATTAATTTTATAGATGG + Intronic
1118776522 14:68977693-68977715 CCCCCTTTTAAGTTTAAAAAAGG + Intronic
1125471348 15:40007396-40007418 CCACCAATTAAGTTTTAAAAGGG - Intronic
1127414606 15:58745805-58745827 GCACATACCCAGTTTAAAGAGGG + Intronic
1128219088 15:65955042-65955064 GAACCTATTAACTTCTAAGATGG - Intronic
1131495658 15:92908680-92908702 GCAGCTATTAAGACTAAAAAGGG - Intronic
1133831332 16:9326182-9326204 GCTGCTATGAAGATTAAAGAAGG - Intergenic
1138177436 16:54913619-54913641 TCATATATAAAGTTTAAAGATGG + Intergenic
1139202478 16:64992328-64992350 GTGCATATTAAGTTTAAAGCAGG + Intronic
1143209675 17:5175867-5175889 TCACCTATAAAGTTAAAATACGG + Intergenic
1144224609 17:13132765-13132787 GCACCTTTTGTCTTTAAAGAGGG - Intergenic
1144539873 17:16130498-16130520 TCAAGTATTGAGTTTAAAGAAGG - Intronic
1149170498 17:53804257-53804279 AAAACTATTAAGTTAAAAGAGGG + Intergenic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1154041442 18:10859944-10859966 GCAGCTAGGAAGTTTAAAGTGGG + Intronic
1164398164 19:27884233-27884255 GCCCCTATTATGTGTAAGGAAGG + Intergenic
1164554354 19:29239547-29239569 GCACCCACTGGGTTTAAAGATGG + Intergenic
1165604269 19:37086829-37086851 GCACATTTTAAATATAAAGATGG - Intronic
925101994 2:1255033-1255055 GCACCTCTTATGTTAAAAGAGGG - Intronic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
933594611 2:84270458-84270480 GCACTTATTAAGAATAAATAAGG - Intergenic
935620311 2:105124285-105124307 GCACCTATTAAATTTGACAAGGG + Intergenic
936629124 2:114181426-114181448 GGTCCTATTAGGTTTAAAGGTGG - Intergenic
937169898 2:119855501-119855523 GCCCCTATTATATGTAAAGAAGG - Intronic
940432211 2:153606106-153606128 GCACCCATTAGGTTGAAAGCAGG + Intergenic
944570527 2:201040208-201040230 GAGCCTATTAAGTATAAACATGG + Intronic
946783228 2:223214869-223214891 GGACTAATTAAGTTTAAAGCTGG - Intergenic
947019236 2:225656326-225656348 ACAGCTATTAAGTATACAGAAGG - Intergenic
1175694005 20:61087623-61087645 GGCCCTATTAATTTTAGAGAAGG - Intergenic
1178262459 21:31112752-31112774 GCTCCTAATCAGTTTGAAGAAGG - Intergenic
1182019838 22:27072246-27072268 GCACCAAGTATGCTTAAAGAGGG - Intergenic
949358894 3:3210880-3210902 GCACCCATTATATTTAGAGAAGG - Intergenic
949678393 3:6484586-6484608 ACACCTATTATCTTTTAAGAAGG - Intergenic
950052146 3:10000337-10000359 GCCTCTATTAAGTTTTAAGATGG + Intronic
950059448 3:10057660-10057682 GCCTCCATTAAGTTTTAAGATGG + Intronic
951878057 3:27450151-27450173 TCACCTTTTAAATTAAAAGAGGG + Intronic
952124589 3:30285577-30285599 GCAAGTATTCAGTTGAAAGAAGG + Intergenic
956334329 3:68146357-68146379 GCACCTCTTAAGGAGAAAGACGG - Intronic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
956944471 3:74203986-74204008 GCAGCTTTTAAGTATTAAGATGG + Intergenic
959146298 3:102549618-102549640 GCACATATCCAGTTCAAAGAAGG - Intergenic
960078681 3:113516729-113516751 GCACTTAGTAAGTGTAAAGTAGG - Intergenic
963098479 3:141573177-141573199 GATCCTATTAAATTGAAAGAGGG + Exonic
963523445 3:146385595-146385617 GCAAATATAAAGTTTAAAAATGG - Intergenic
964832738 3:160903604-160903626 GTAGCTATTATTTTTAAAGATGG + Intronic
970762675 4:19510193-19510215 GCGCCTATTAATTTTAAAAGGGG + Intergenic
976987543 4:91320839-91320861 GAACCTATTATCTTTCAAGAGGG - Intronic
977246005 4:94632170-94632192 GCCCTTACTGAGTTTAAAGAAGG - Intronic
977402811 4:96555297-96555319 ATACCTATTAAGTTTCAAAATGG + Intergenic
988231765 5:28488710-28488732 TCACCTCTCAAGTGTAAAGAGGG - Intergenic
992324981 5:75651634-75651656 TCACCTATTTGGTTCAAAGAGGG + Intronic
994613562 5:102076790-102076812 GCACTTTTTAAGTTTCATGAAGG + Intergenic
995656238 5:114429587-114429609 GAAGCTTTTAAGTTTAATGAAGG + Intronic
1001859384 5:175040142-175040164 GCTGCTATTAAGTTGAAAGAGGG - Intergenic
1013931162 6:115534650-115534672 GCCATTGTTAAGTTTAAAGAGGG + Intergenic
1015649081 6:135434100-135434122 GAACATATTAATTTTAAATATGG + Intronic
1023339333 7:39203193-39203215 ACACTTATAAATTTTAAAGAAGG - Intronic
1024613294 7:51085345-51085367 GTACCTATGAAGTACAAAGAAGG + Intronic
1027655385 7:80923957-80923979 GCATTTAATAACTTTAAAGAAGG + Intergenic
1029052750 7:97706455-97706477 GCAACTATTAAGTTTTGAGAGGG - Intergenic
1031718703 7:125141101-125141123 GCAACTATTAATTTTTAAAAGGG + Intergenic
1033417285 7:141173835-141173857 GCCCCTATTAAGTCTATATATGG - Intronic
1034388117 7:150757830-150757852 AAACCTATTAATTTTAAAAAGGG + Intergenic
1038666557 8:29542698-29542720 GCACTTATTAAATTTAGTGAGGG - Intergenic
1039193274 8:35001478-35001500 GCATGTATTAAGTTCAAAAATGG - Intergenic
1047588834 8:126304306-126304328 GCACCTGTAAAGTATAAAGCAGG + Intergenic
1048091195 8:131242091-131242113 GCACCAATCATGTATAAAGAGGG + Intergenic
1048145758 8:131841420-131841442 GCACCTAATTAGGTTAAAGGCGG + Intergenic
1050712552 9:8482079-8482101 GAAGTTATTAAGATTAAAGATGG - Intronic
1050804955 9:9664255-9664277 GCAGTTATTAAGTTCATAGATGG - Intronic
1051753973 9:20375308-20375330 GCAACTATTAACTTTGAAAAAGG + Intronic
1052922911 9:33986903-33986925 GCACCTATTAAAGGCAAAGAAGG + Intronic
1053240250 9:36488778-36488800 GCACCTATTAAGTGTCAGCATGG - Intergenic
1055574788 9:77649843-77649865 TGACCTATTAGGTTTAAAGTTGG + Intergenic
1055960108 9:81812271-81812293 GTACCTATTAAAATTAAAGCTGG + Intergenic
1186318894 X:8402260-8402282 GCAGCCATTAAGTCTAAAGGGGG - Intergenic
1186956991 X:14694351-14694373 GCACCTACTATGCTTAAACATGG + Intronic
1193102424 X:77629617-77629639 GCCCCTCTTAAGTTTTAACAAGG + Intronic
1197043948 X:121973603-121973625 ACACCTAATAAGTTTTAAGAGGG + Intergenic
1197088947 X:122513330-122513352 GCACCTCTTAGGTTTTAATAAGG - Intergenic
1198704457 X:139433723-139433745 GCACTTATTCAGTCTAGAGAGGG - Intergenic
1200246689 X:154530284-154530306 GCACCTCTTGAGTTTTCAGAGGG - Intergenic