ID: 926018588

View in Genome Browser
Species Human (GRCh38)
Location 2:9474987-9475009
Sequence GGGTCCGGGTTAGCGGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 48}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926018570_926018588 15 Left 926018570 2:9474949-9474971 CCCCTCAGCGCCCTCCTGGGCAG 0: 1
1: 0
2: 4
3: 29
4: 356
Right 926018588 2:9474987-9475009 GGGTCCGGGTTAGCGGCCGCGGG 0: 1
1: 0
2: 1
3: 6
4: 48
926018571_926018588 14 Left 926018571 2:9474950-9474972 CCCTCAGCGCCCTCCTGGGCAGC 0: 1
1: 0
2: 3
3: 30
4: 301
Right 926018588 2:9474987-9475009 GGGTCCGGGTTAGCGGCCGCGGG 0: 1
1: 0
2: 1
3: 6
4: 48
926018574_926018588 5 Left 926018574 2:9474959-9474981 CCCTCCTGGGCAGCGGCCTTTCC 0: 1
1: 0
2: 0
3: 29
4: 241
Right 926018588 2:9474987-9475009 GGGTCCGGGTTAGCGGCCGCGGG 0: 1
1: 0
2: 1
3: 6
4: 48
926018576_926018588 1 Left 926018576 2:9474963-9474985 CCTGGGCAGCGGCCTTTCCCCTC 0: 1
1: 0
2: 0
3: 19
4: 268
Right 926018588 2:9474987-9475009 GGGTCCGGGTTAGCGGCCGCGGG 0: 1
1: 0
2: 1
3: 6
4: 48
926018572_926018588 13 Left 926018572 2:9474951-9474973 CCTCAGCGCCCTCCTGGGCAGCG 0: 1
1: 0
2: 0
3: 19
4: 412
Right 926018588 2:9474987-9475009 GGGTCCGGGTTAGCGGCCGCGGG 0: 1
1: 0
2: 1
3: 6
4: 48
926018575_926018588 4 Left 926018575 2:9474960-9474982 CCTCCTGGGCAGCGGCCTTTCCC 0: 1
1: 0
2: 3
3: 19
4: 245
Right 926018588 2:9474987-9475009 GGGTCCGGGTTAGCGGCCGCGGG 0: 1
1: 0
2: 1
3: 6
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926018588 Original CRISPR GGGTCCGGGTTAGCGGCCGC GGG Intronic
900317705 1:2067642-2067664 GGGTCCGCATGAGGGGCCGCAGG + Intronic
903788390 1:25875895-25875917 GGGTCGGGGAGGGCGGCCGCAGG + Intergenic
906314195 1:44775780-44775802 GGCTCCGGGTTCCGGGCCGCGGG + Intronic
910359076 1:86396373-86396395 TGGTCCGGGTTAGGGACGGCGGG + Intergenic
922496757 1:226063099-226063121 GGGTCCGGGGAAGGGGCGGCGGG - Intronic
922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG + Exonic
1089511156 11:118998127-118998149 GGGTCAGGGTCAGAGGCCGCCGG + Exonic
1094819120 12:34211222-34211244 GGGTCCGGGGCAGAGGCTGCTGG + Intergenic
1108292505 13:48975835-48975857 GGGTTCGGGGTCCCGGCCGCGGG + Intergenic
1121318018 14:92973781-92973803 GGGCCCGGGTGAGAGGCCCCGGG + Intronic
1122719810 14:103715798-103715820 GGGGCCGGGTGCGGGGCCGCTGG + Exonic
1122880791 14:104689669-104689691 GGGGCCGGGTCAGGGGCTGCGGG - Exonic
1135016177 16:18926471-18926493 GGGGCGGGGTTGGCGCCCGCCGG + Intergenic
1138497296 16:57416270-57416292 GGGTCCTGGGAGGCGGCCGCTGG + Intergenic
1138591193 16:58000554-58000576 GGGGACGGGCTAGCGGCGGCCGG + Intronic
1139410009 16:66751524-66751546 GGGCCCGCGGTGGCGGCCGCCGG - Exonic
1139597792 16:67968369-67968391 GGGCCCGGGATGGCGGCCCCGGG + Intronic
1142335979 16:89490017-89490039 GGGTCCGGGTTCGGGGCAGCCGG - Intronic
1152516610 17:80828532-80828554 GGGTCGGGGTTAGGGGCCTCAGG - Intronic
1154299709 18:13182448-13182470 GGGTCCAGGGGAGCAGCCGCAGG - Intergenic
1154954672 18:21242386-21242408 AGGGCCAGGTGAGCGGCCGCGGG + Intronic
1160952513 19:1674487-1674509 GGGTCCGGGGTCGGGGCTGCAGG - Intergenic
1163503235 19:17688247-17688269 GGGTCGGGCTCAGCGGCCGCTGG + Intronic
1163593148 19:18205342-18205364 GGGACTGGGTTGGCGGCGGCTGG - Intergenic
1168692715 19:58386549-58386571 GGGCCCGGGGTTGCGGCGGCGGG - Intronic
925959904 2:9004232-9004254 GGGCCCGGGGTGGCGGCCGGAGG + Intergenic
926018588 2:9474987-9475009 GGGTCCGGGTTAGCGGCCGCGGG + Intronic
926154944 2:10448447-10448469 GGGCCCGGGTTGGCCACCGCCGG - Exonic
927981947 2:27380053-27380075 GGTTAAGGATTAGCGGCCGCTGG - Intronic
929452780 2:42048053-42048075 GGGGCCGGGGTCGGGGCCGCCGG + Exonic
945119618 2:206443931-206443953 GGGGCCGCGTTGGGGGCCGCAGG - Exonic
1169204616 20:3732743-3732765 GGGCCCGGGATCGCGGCGGCTGG + Exonic
1171217991 20:23365979-23366001 GGGACCGCGACAGCGGCCGCGGG + Intronic
1179024323 21:37667533-37667555 GGGTCCGGGGTAGCGGGCGCCGG + Intronic
1179024366 21:37667665-37667687 AGGTCCGGGGTAGCGGGCTCCGG + Intronic
1180843817 22:18970942-18970964 AGGTCCGGGGTGGGGGCCGCGGG + Intergenic
954112178 3:48440270-48440292 GGGTCTGGGGAAGCGGCGGCAGG + Exonic
992828172 5:80569807-80569829 GGTTCCAGTTTTGCGGCCGCTGG - Intronic
1006677368 6:35774063-35774085 GTGTCAGGGTTAGCAGCCCCTGG - Intergenic
1012401197 6:98843856-98843878 GGGGCCGGGTGAGTGGCCGCGGG - Intergenic
1016330170 6:142946206-142946228 GGGCCCGGGGCAGGGGCCGCCGG + Intergenic
1019392233 7:794968-794990 GGGTCCAGGTTACAGTCCGCGGG - Intergenic
1019392263 7:795052-795074 GGGTCCAGGTTACAGTCCGCGGG - Intergenic
1019392278 7:795094-795116 GGGTCCAGGTTAGAGTCCGCGGG - Intergenic
1019472596 7:1229566-1229588 GGGTCCGGGTCGGGGGCGGCCGG - Intergenic
1020238554 7:6374785-6374807 GGGGCCGGGCTGGAGGCCGCGGG + Intronic
1029746396 7:102517745-102517767 GGGTCCGGGGTGGCGGGCGGCGG + Exonic
1029764335 7:102616724-102616746 GGGTCCGGGGTGGCGGGCGGCGG + Exonic
1032787341 7:135211365-135211387 GGTTCCGGGTGAGAGGCCGGCGG - Exonic
1034911762 7:155003237-155003259 GGCTCCGGGGTAGCTGGCGCCGG + Intergenic
1037879533 8:22566078-22566100 AGGACCGGGGTCGCGGCCGCCGG + Intronic
1038535023 8:28347573-28347595 GGGTTTGGGTTAGTGGCTGCTGG - Exonic
1042271855 8:66962748-66962770 GGGGCCGGGCTGGAGGCCGCGGG + Intergenic
1045336067 8:101205420-101205442 CGGCCCGGGTGAGCGGCAGCGGG - Intronic
1045847881 8:106658316-106658338 GTGGCCGGGGTGGCGGCCGCCGG + Intronic
1190072745 X:47292476-47292498 GGGGCAGGGTTAGGGGCTGCTGG + Intergenic