ID: 926020182

View in Genome Browser
Species Human (GRCh38)
Location 2:9487834-9487856
Sequence GCGCGCGCGCGCGCGCGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 579
Summary {0: 1, 1: 2, 2: 32, 3: 104, 4: 440}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926020181_926020182 28 Left 926020181 2:9487783-9487805 CCTTTTTGTGTGTGTGTGTGTGT 0: 113
1: 1013
2: 4073
3: 4782
4: 7797
Right 926020182 2:9487834-9487856 GCGCGCGCGCGCGCGCGCTGTGG 0: 1
1: 2
2: 32
3: 104
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926020182 Original CRISPR GCGCGCGCGCGCGCGCGCTG TGG Intronic