ID: 926027540

View in Genome Browser
Species Human (GRCh38)
Location 2:9557686-9557708
Sequence CTGGTTATTCAGGCCAGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 387}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926027540_926027543 -5 Left 926027540 2:9557686-9557708 CCGCGCCTGGCCTGAATAACCAG 0: 1
1: 0
2: 3
3: 50
4: 387
Right 926027543 2:9557704-9557726 ACCAGAAGTCCTAGATTTCCAGG 0: 1
1: 0
2: 0
3: 19
4: 170
926027540_926027545 -4 Left 926027540 2:9557686-9557708 CCGCGCCTGGCCTGAATAACCAG 0: 1
1: 0
2: 3
3: 50
4: 387
Right 926027545 2:9557705-9557727 CCAGAAGTCCTAGATTTCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926027540 Original CRISPR CTGGTTATTCAGGCCAGGCG CGG (reversed) Intergenic
900247044 1:1641216-1641238 ATGGATATGCAGGCCGGGCGCGG + Intronic
900282115 1:1877008-1877030 CTATATATACAGGCCAGGCGTGG + Intronic
900947196 1:5837655-5837677 CTGGCAATTCAGGCCGGGAGCGG + Intergenic
901339363 1:8481402-8481424 CTGGTTAATCGGGCCGGGTGCGG - Intronic
901354735 1:8635023-8635045 ATCTTTATTCAGGCCAGGCGCGG - Intronic
901533018 1:9865308-9865330 ATGGGTATTAAGGCCGGGCGCGG + Intronic
903233370 1:21935193-21935215 AAAGTTTTTCAGGCCAGGCGCGG - Intronic
903271801 1:22193415-22193437 GTGGCTATCCAGGCCAGGCGTGG - Intergenic
904180322 1:28662107-28662129 CTGTTTTTTCAGGCCAGGTGTGG + Intergenic
904399137 1:30244330-30244352 CTGGGGATTCAGGCAAGGGGTGG - Intergenic
905110649 1:35591995-35592017 TTAGTTTTTCAGGCCAGGCAAGG + Intronic
905372839 1:37494538-37494560 ATTGTATTTCAGGCCAGGCGTGG + Intronic
905428696 1:37905108-37905130 TATGTTATTGAGGCCAGGCGTGG + Intronic
906274913 1:44508204-44508226 CTGTTTCCTCGGGCCAGGCGGGG + Intronic
907436826 1:54455088-54455110 AAGGTAATTCAGGCCAGGTGAGG - Intergenic
907439466 1:54470181-54470203 GTGGTGGTTTAGGCCAGGCGTGG - Intergenic
907439471 1:54470200-54470222 GTGGTGGTTTAGGCCAGGCGTGG - Intergenic
907966825 1:59339751-59339773 CTGGAAATTAAGGCCAGGCATGG - Intronic
908085474 1:60628047-60628069 TTGTTTATTCCAGCCAGGCGCGG + Intergenic
908490626 1:64640383-64640405 ATTTTTATTGAGGCCAGGCGTGG + Intronic
908760243 1:67505160-67505182 TTGCCAATTCAGGCCAGGCGTGG + Intergenic
910271209 1:85396742-85396764 ATATTTATTCAGGCCAGGTGTGG + Intronic
910372495 1:86531584-86531606 CTGGGTAATCTGGCCGGGCGCGG + Intergenic
911718103 1:101158603-101158625 CTGATTGTTCAGGGCAGGAGAGG + Intergenic
912125389 1:106531000-106531022 CTGTTTTTGCTGGCCAGGCGCGG - Intergenic
912484368 1:110013417-110013439 TTTATTATTCAGGCCAGGCCTGG + Intronic
912834111 1:112980320-112980342 CTGGTTGAACAGGCCAAGCGTGG - Intergenic
913582073 1:120236116-120236138 GCGGGTATCCAGGCCAGGCGCGG + Intergenic
913626101 1:120662275-120662297 GCGGGTATCCAGGCCAGGCGCGG - Intergenic
914564003 1:148847576-148847598 GCGGGTATCCAGGCCAGGCGCGG + Intronic
914608823 1:149282642-149282664 GCGGGTATCCAGGCCAGGCGCGG - Intergenic
916267886 1:162909591-162909613 TGGGGTATTCAGGCCCGGCGTGG + Intergenic
916493901 1:165327581-165327603 CTGGTTGTTCAGGGCAGTGGAGG - Intronic
916931321 1:169580659-169580681 TTGTGTATTGAGGCCAGGCGTGG - Intronic
918062551 1:181074523-181074545 CTGGTTGTTTAGGACAAGCGTGG + Intergenic
919101489 1:193102641-193102663 CTAGTATTTCAGGCCAGGCGCGG - Intronic
919175358 1:194011701-194011723 CTGGATTTACAGGCCAGGCATGG - Intergenic
919346205 1:196382395-196382417 TTGGTTAAACAGGCCGGGCGCGG - Intronic
920256027 1:204655094-204655116 CTGTTTCTTCAGGCAAGGCCTGG - Intronic
920343418 1:205290313-205290335 GTAGTAATTAAGGCCAGGCGCGG + Intergenic
922344919 1:224688655-224688677 CTCCTTATATAGGCCAGGCGCGG + Intronic
922491487 1:226020624-226020646 CTGCATGTTCAGGCCAGGCATGG - Intergenic
922524012 1:226283655-226283677 CTGCTTTTCCAGGCCAGGCATGG + Intronic
923023358 1:230184477-230184499 ATTGATCTTCAGGCCAGGCGCGG - Intronic
923366821 1:233269836-233269858 CTGGTTATTTATGCCATCCGTGG + Intronic
923815149 1:237369111-237369133 ATGTTGATTCAGGCCAGGCGTGG - Intronic
924101589 1:240608925-240608947 CTGTCTATACAGGCCAGGAGAGG - Intronic
1063475021 10:6320713-6320735 CTGCTGCTTCTGGCCAGGCGTGG - Intergenic
1065900662 10:30204723-30204745 AAAGTTATTCTGGCCAGGCGTGG + Intergenic
1066405181 10:35111595-35111617 TTAGACATTCAGGCCAGGCGTGG + Intergenic
1067115041 10:43428983-43429005 GTGGTTAGTTTGGCCAGGCGCGG + Intergenic
1067299496 10:44995936-44995958 CTGGTTCTTGAGGCCTGGCCTGG - Intergenic
1067860221 10:49839044-49839066 GAAGTTATTTAGGCCAGGCGTGG + Intronic
1068276581 10:54806772-54806794 GTGGTGGCTCAGGCCAGGCGAGG - Intronic
1069441804 10:68435380-68435402 ATTTTTATTTAGGCCAGGCGTGG + Intronic
1070118317 10:73550814-73550836 ATTGTTTTTCCGGCCAGGCGTGG + Intronic
1070550871 10:77489627-77489649 AAGGTTGTCCAGGCCAGGCGCGG - Intronic
1070579515 10:77709427-77709449 CTGGTTATTGATGACAGGTGAGG - Intergenic
1071738453 10:88328196-88328218 ATGTTAATTCAGGCCAGGCACGG - Intronic
1072264531 10:93714556-93714578 ATAGTCATCCAGGCCAGGCGCGG + Intergenic
1072343416 10:94478416-94478438 CTGGAAATGTAGGCCAGGCGTGG + Intronic
1072800262 10:98387922-98387944 CAGCTTGATCAGGCCAGGCGTGG - Intronic
1073107698 10:101041807-101041829 CTGGTTATCTAGGCCGGGCACGG - Intergenic
1073254706 10:102143308-102143330 CTGGGAATCCAGGCCAGGCGTGG + Intronic
1073317115 10:102590453-102590475 AGGGTTATACAGGCCTGGCGTGG - Intronic
1074281775 10:112058969-112058991 CTTCTTATTCATGCCAGGCCAGG - Intergenic
1075840990 10:125503078-125503100 TTAGTTTTTCAGGCCAGGCGTGG - Intergenic
1076552512 10:131291714-131291736 CTGTTTATGGAGGCCGGGCGCGG - Intronic
1077084377 11:741247-741269 CAAGTTTATCAGGCCAGGCGCGG + Intergenic
1077806464 11:5595969-5595991 ATGGTTTCTGAGGCCAGGCGCGG - Intronic
1078222217 11:9361231-9361253 CTGTTTAATTAGGCCAGGCGCGG - Intergenic
1079116158 11:17641830-17641852 CTGGTTCTACAGGCCAGGGCGGG - Exonic
1079894716 11:26103961-26103983 TTGATGATTGAGGCCAGGCGCGG + Intergenic
1080264220 11:30384743-30384765 CTGGGTATCCTGGCCAGGCGCGG - Intronic
1080629847 11:34064056-34064078 ATGTATCTTCAGGCCAGGCGCGG - Intronic
1082880994 11:58038019-58038041 ATAGTTATTCTGGCCGGGCGCGG - Intronic
1083025846 11:59550214-59550236 ATGCTTTTTGAGGCCAGGCGCGG - Intergenic
1083097238 11:60264107-60264129 CTGGTTATTCAGGGCATGGTAGG - Intergenic
1083707839 11:64529013-64529035 CTTGTTTTTTAGGCCAGGCTCGG - Intergenic
1084732184 11:71080772-71080794 CTGGTGGCTCAGGCCATGCGAGG - Intronic
1085011483 11:73144223-73144245 GTGCTTATTGAGGCCAGGCGCGG + Intergenic
1087646201 11:100811244-100811266 ATGTTTATTCTGGCCAGGCATGG - Intronic
1088228106 11:107643980-107644002 TTTATTATTCAGGCCAGGCACGG + Intronic
1089402240 11:118171052-118171074 CTGGTCACTCGGGCCAGGGGCGG - Intronic
1090171199 11:124606275-124606297 CTGATTAGTCAGGCCAGGCGCGG + Intergenic
1090335468 11:125960209-125960231 CTGATAATACAGGCCAGACGTGG + Exonic
1091809264 12:3381197-3381219 CTGGTTTTCCATGCCAGGCCAGG - Intergenic
1093752575 12:22817867-22817889 TTGGAAATTTAGGCCAGGCGTGG + Intergenic
1094627848 12:32141762-32141784 ATGGGTGTCCAGGCCAGGCGCGG - Intronic
1094695204 12:32810969-32810991 ATGTTTATTCTGGCCGGGCGCGG - Intronic
1095479506 12:42620778-42620800 ATGGCTATTCCGGCCGGGCGTGG + Intergenic
1095701529 12:45195634-45195656 CAGATTTTTAAGGCCAGGCGCGG + Intergenic
1096304837 12:50465079-50465101 ATGGTGGCTCAGGCCAGGCGTGG + Intronic
1096338722 12:50778511-50778533 ATGGTTAATATGGCCAGGCGCGG - Intronic
1097860649 12:64515343-64515365 ATGTTTAATTAGGCCAGGCGTGG - Intergenic
1098327940 12:69322329-69322351 GTGGTGGGTCAGGCCAGGCGTGG - Intergenic
1098446235 12:70568585-70568607 GTGGGCATTCGGGCCAGGCGCGG - Intronic
1099710525 12:86218888-86218910 ATGTAAATTCAGGCCAGGCGTGG + Intronic
1100532100 12:95470228-95470250 CTGCTAGTTCAGGCCGGGCGCGG - Intergenic
1101864820 12:108512938-108512960 ATGGATCTTCTGGCCAGGCGCGG + Intergenic
1102695059 12:114792446-114792468 CTGGTTAGACAGGCCAGGCGTGG - Intergenic
1103247993 12:119474714-119474736 ATTTTTCTTCAGGCCAGGCGTGG + Intronic
1103324137 12:120109161-120109183 ATGGGGTTTCAGGCCAGGCGCGG + Intronic
1104480516 12:129103671-129103693 ATGGTTACCTAGGCCAGGCGTGG - Intronic
1104985035 12:132591909-132591931 CTGGAATTCCAGGCCAGGCGCGG + Intergenic
1104990802 12:132622834-132622856 ATGGGAAGTCAGGCCAGGCGGGG + Intergenic
1105416059 13:20212076-20212098 CTGGACAGTCTGGCCAGGCGTGG - Intergenic
1105772162 13:23622112-23622134 ATGGTCATTCAGGCCTGGCGTGG + Intronic
1105869850 13:24495159-24495181 TTGGTAATTCTGGCCAGGCATGG - Intronic
1106663873 13:31831436-31831458 ATGACTATTGAGGCCAGGCGCGG + Intergenic
1106706141 13:32281783-32281805 CTAGTAAGTCAGGCAAGGCGGGG + Intronic
1106747264 13:32718438-32718460 CTGATTTTTTTGGCCAGGCGTGG - Intronic
1107190846 13:37583713-37583735 AAGACTATTCAGGCCAGGCGTGG - Intronic
1107343076 13:39430869-39430891 CTGGTTATCCAAGCCAGCAGCGG + Intronic
1107454203 13:40539118-40539140 ATGGATATACAGGCCAGGCGCGG + Intergenic
1108048528 13:46406490-46406512 TGGCTTTTTCAGGCCAGGCGCGG + Intronic
1108320900 13:49289416-49289438 ATGCTATTTCAGGCCAGGCGTGG - Intronic
1108394549 13:49979831-49979853 ATCGTTATTATGGCCAGGCGCGG + Intergenic
1109178201 13:59181387-59181409 CTGGGTCTTCTGGCCGGGCGTGG + Intergenic
1109775167 13:67031412-67031434 ATAATTATACAGGCCAGGCGAGG + Intronic
1110702564 13:78566163-78566185 GCGGTGATTCAGGCCGGGCGCGG + Intergenic
1110752392 13:79130298-79130320 CAATTTATTGAGGCCAGGCGGGG - Intergenic
1112510133 13:100001384-100001406 CAGTGTATGCAGGCCAGGCGCGG - Intergenic
1114289515 14:21276412-21276434 CTGAAAATACAGGCCAGGCGCGG - Intergenic
1114585639 14:23810624-23810646 CTTGAAAGTCAGGCCAGGCGTGG - Intergenic
1115745832 14:36436579-36436601 CTGGTAATATAGGCCAGTCGTGG - Intergenic
1115873398 14:37832767-37832789 ATGGGTATTCTGGCCACGCGCGG + Intronic
1116101943 14:40450054-40450076 ATGGTAATTTAGGCCAGGCACGG + Intergenic
1118304097 14:64640174-64640196 CAGTTAATTCGGGCCAGGCGCGG + Intergenic
1119028614 14:71174140-71174162 CTGGTCCTTCCGGCCAGGCCTGG + Intergenic
1119041690 14:71280246-71280268 CTGACTATTCAGTCCAGGCTTGG - Intergenic
1120017435 14:79489747-79489769 CTGGTAATTTCGGCCGGGCGTGG + Intronic
1121523393 14:94601610-94601632 CTGATGCTTCTGGCCAGGCGTGG - Intronic
1122208055 14:100158109-100158131 AAAGTTGTTCAGGCCAGGCGTGG + Intronic
1122212900 14:100184329-100184351 AAAGTTGTTCAGGCCAGGCGTGG + Intergenic
1122250445 14:100435573-100435595 CTGGATGTTAAGGCCAGGCCAGG - Intronic
1122709399 14:103644546-103644568 CAGGTCATGCAGGCCGGGCGCGG - Intronic
1122875636 14:104663288-104663310 CTACTGATTCAGGCCAGGCATGG + Intergenic
1122951743 14:105048764-105048786 CTGTTTACTCAGGCTGGGCGCGG - Intergenic
1125472654 15:40019867-40019889 CTTCTTGTTCAGGCCAGGCATGG + Intronic
1127408607 15:58681101-58681123 CATGTTATTTAGGCCAGGCATGG - Intronic
1127594569 15:60466040-60466062 CTACTTAAACAGGCCAGGCGTGG - Intronic
1128737548 15:70061748-70061770 CTGGTGCTGCAGGCCAGGAGTGG + Intronic
1128805471 15:70527735-70527757 CTGTCCTTTCAGGCCAGGCGTGG + Intergenic
1129260033 15:74360572-74360594 CTGGTAAGTTAGGCCAGGCGCGG - Intronic
1129448687 15:75637098-75637120 CTCAAAATTCAGGCCAGGCGCGG - Intergenic
1129562155 15:76581874-76581896 ATGCTTTTTCAGGCCAGGCATGG - Intronic
1131130053 15:89892952-89892974 ATGAGTATTCAGGCCGGGCGCGG - Intronic
1131521569 15:93119960-93119982 AAGCATATTCAGGCCAGGCGCGG - Intergenic
1132810361 16:1794095-1794117 CTGGCTACTCAGGCCAGGGGTGG - Intronic
1134278265 16:12795791-12795813 ATGGTCACTGAGGCCAGGCGTGG + Intronic
1134534401 16:15013914-15013936 CTGCTTATTTAGGCCGGGTGCGG + Intronic
1134823928 16:17269465-17269487 TTAGTGTTTCAGGCCAGGCGTGG - Intronic
1135293389 16:21259396-21259418 AAGTTTGTTCAGGCCAGGCGTGG - Intronic
1135431750 16:22390275-22390297 ATGTCTATTCAGGCCAGGCGCGG + Intronic
1136005802 16:27327919-27327941 ATGATTATTGAGGCCAGGTGCGG + Intronic
1136520274 16:30791092-30791114 CAGGAAATTCAGGCCAGGCGCGG - Intergenic
1137906221 16:52324782-52324804 ATAGTTAGTTAGGCCAGGCGTGG - Intergenic
1137990360 16:53147911-53147933 TTGCTTATTTAGGCCAGGCGCGG + Intronic
1138078550 16:54066539-54066561 CTAGCTATTCAGACCAGGCCAGG + Intronic
1139366328 16:66435775-66435797 CCAGTTATTTTGGCCAGGCGTGG - Intronic
1140432415 16:74915712-74915734 CTGGGTTTTCTGGCCAGGCGCGG - Intronic
1140470104 16:75209106-75209128 CAGGTCACTCAGGCCAGGTGAGG - Intergenic
1140835072 16:78786198-78786220 ATATTAATTCAGGCCAGGCGCGG - Intronic
1141369188 16:83471562-83471584 GTGGTTAGAAAGGCCAGGCGAGG - Intronic
1142159730 16:88550898-88550920 ATGCGAATTCAGGCCAGGCGAGG + Intergenic
1142720181 17:1770748-1770770 AAGATTATTCTGGCCAGGCGCGG - Intronic
1143549351 17:7620172-7620194 GTGGTAATACTGGCCAGGCGTGG + Intronic
1143701709 17:8665417-8665439 GTGGTTAGCCACGCCAGGCGCGG - Intergenic
1143916799 17:10300107-10300129 ATCCTGATTCAGGCCAGGCGCGG + Intronic
1144100012 17:11934740-11934762 CGGCTTTGTCAGGCCAGGCGCGG - Intronic
1144675787 17:17160783-17160805 CTGGTCACACAGGCCAGGCTAGG - Intronic
1144815480 17:18031489-18031511 GTGTTTTTTTAGGCCAGGCGCGG + Intronic
1145001645 17:19309417-19309439 CTGACTTTTGAGGCCAGGCGCGG - Intronic
1145212607 17:21025967-21025989 ATGGTTAATAGGGCCAGGCGCGG + Intronic
1145214070 17:21039285-21039307 ATGGCAATTCGGGCCAGGCGCGG + Intronic
1145354758 17:22132559-22132581 TTTGATATACAGGCCAGGCGCGG + Intergenic
1145729685 17:27167058-27167080 CAGAGTATTCAGGCCAGGCACGG + Intergenic
1145807181 17:27743048-27743070 CTCATTTTTCAGGCCAGGCATGG + Intergenic
1146460782 17:33044649-33044671 ATGTTTATTGGGGCCAGGCGTGG - Intronic
1146867122 17:36347052-36347074 CTGGTTAATCAGTCCAAGCAAGG + Intronic
1146916004 17:36678876-36678898 ATGTTTTTTCAGGCCAGGTGCGG - Intergenic
1147069992 17:37947661-37947683 CTGGTTAATCAGTCCAAGCAAGG + Intergenic
1147081514 17:38027181-38027203 CTGGTTAATCAGTCCAAGCAAGG + Intronic
1147097465 17:38151156-38151178 CTGGTTAATCAGTCCAAGCAAGG + Intergenic
1147483053 17:40785510-40785532 CTGGTTCTTTACGCCAGGCACGG - Intergenic
1147927983 17:43956908-43956930 AGTGTAATTCAGGCCAGGCGTGG + Intronic
1147959387 17:44157086-44157108 CTGGTAATTAAGGCCAGGCACGG - Intronic
1148776214 17:50096939-50096961 ATGGGCATTCAGGCCAGGCTGGG + Intronic
1149834781 17:59902869-59902891 AGGTTTATTCAGGCCAGGCGAGG - Intronic
1149974064 17:61248479-61248501 CTGGGAATTCATGCCAGGCTGGG - Intronic
1150079171 17:62221279-62221301 CTGGTTAATCAGTCCAAGCAAGG + Intergenic
1150236636 17:63598359-63598381 TAGTTTATTCAGGCCAGGCATGG - Intergenic
1150238826 17:63615527-63615549 ATGCTCATTCAGGCCAGGTGTGG - Intergenic
1150337337 17:64340381-64340403 GTGGCTACTCAGGCTAGGCGTGG - Intronic
1150911721 17:69394820-69394842 GTGTTTATACTGGCCAGGCGTGG - Intergenic
1151356289 17:73560628-73560650 AGGGTTAATGAGGCCAGGCGAGG - Intronic
1151838077 17:76597166-76597188 CTGTTTATCTTGGCCAGGCGCGG - Intergenic
1151877128 17:76873165-76873187 CTGGATTCTCAGGCCAGGCTAGG + Intronic
1152047461 17:77946878-77946900 ATGTTTGTTGAGGCCAGGCGCGG - Intergenic
1153631459 18:7074121-7074143 GTGGTTGTTCTGGCCGGGCGTGG - Intronic
1153902807 18:9633910-9633932 TTGGTAATTTGGGCCAGGCGTGG + Intergenic
1157585179 18:48796464-48796486 CTGGGCATTCAGGCCAGGTGTGG - Intronic
1157799510 18:50607809-50607831 CAGCTTATTCAGGCCAGGAAGGG - Intronic
1159689224 18:71465278-71465300 GTGGTGGTTCAGGCCAAGCGTGG + Intergenic
1161243686 19:3237020-3237042 ATGGCTACTCCGGCCAGGCGTGG + Intronic
1161260740 19:3336650-3336672 CTGGTTGTGCAGGGCAGGCCTGG + Intergenic
1161503885 19:4633580-4633602 CCTGAGATTCAGGCCAGGCGTGG + Intergenic
1161513803 19:4685471-4685493 CTGTGTAGTCAGGGCAGGCGGGG + Intronic
1161677204 19:5658547-5658569 CTGGGCATGTAGGCCAGGCGCGG + Intronic
1161889927 19:7027630-7027652 CTGGTCATTTAGGCCGGGCGCGG + Intergenic
1161891525 19:7043116-7043138 CTGGTCATTTAGGCCGGGCGCGG - Intergenic
1161893609 19:7061573-7061595 CTGGTCATTTAGGCCGGGCGCGG - Intergenic
1162347334 19:10127087-10127109 AAGGAAATTCAGGCCAGGCGCGG + Intergenic
1162800286 19:13106360-13106382 ATGTTTATTAAGGCCAGGCATGG - Intronic
1162886482 19:13701406-13701428 CTGGATATTCTGGCCGGGCACGG - Intergenic
1164565978 19:29326423-29326445 CTGGTTATTTATGCCTGGGGAGG + Intergenic
1164914978 19:32045212-32045234 ATGGTATTCCAGGCCAGGCGTGG + Intergenic
1165038560 19:33052665-33052687 CTGGAGATTCAGGGCAGGCTGGG + Intronic
1165048691 19:33127226-33127248 ATGAAAATTCAGGCCAGGCGCGG + Intronic
1165503739 19:36211150-36211172 CTAATTAATAAGGCCAGGCGAGG + Intronic
1165530632 19:36397381-36397403 TTGGTTTATGAGGCCAGGCGCGG - Intronic
1165911612 19:39232093-39232115 CATCTTATTCAGGCCAGGCATGG - Intergenic
1165931137 19:39359893-39359915 TTTGTTCTCCAGGCCAGGCGCGG + Intronic
1166076097 19:40414680-40414702 CTGGTGAGTCAGGGCAGGCTGGG - Intergenic
1166206989 19:41276806-41276828 CAGGTTATTCTCGCCAGGTGTGG + Intronic
1166215213 19:41330523-41330545 ATAGTAGTTCAGGCCAGGCGGGG - Exonic
1166816559 19:45549865-45549887 ATGCTGTTTCAGGCCAGGCGCGG + Intronic
1167366560 19:49057725-49057747 CTGGTCCTTCTGGCCTGGCGTGG + Exonic
1167413375 19:49357805-49357827 CTGGTTGTTTAGGCCAGGTGTGG + Intronic
925131989 2:1500674-1500696 CTTGATATTAAGGCCGGGCGTGG + Intronic
925543049 2:4987676-4987698 GTGGATACACAGGCCAGGCGTGG + Intergenic
926027540 2:9557686-9557708 CTGGTTATTCAGGCCAGGCGCGG - Intergenic
927686652 2:25175777-25175799 ATAGTTAACCAGGCCAGGCGTGG + Intergenic
927723784 2:25405216-25405238 GTGGTTAGTCGGGCCAGGCATGG - Intronic
928454861 2:31410992-31411014 ATATTTATTCTGGCCAGGCGCGG + Intronic
928492912 2:31802995-31803017 AAGATTCTTCAGGCCAGGCGCGG + Intergenic
928898425 2:36292249-36292271 CAGATTATCCAGGCCAGGCGTGG + Intergenic
931551980 2:63456724-63456746 TTGGTTCTTCAGGCCAGGCACGG + Intronic
931683777 2:64775096-64775118 CTTGAAAGTCAGGCCAGGCGTGG + Intergenic
931749362 2:65317220-65317242 ATGGTTACCCTGGCCAGGCGCGG + Intronic
935821146 2:106894054-106894076 ATGGATATCTAGGCCAGGCGTGG - Intergenic
936501571 2:113070759-113070781 CTGGTTTTTCAGGCCTGGGGTGG - Intronic
936581909 2:113707849-113707871 CTTTATATTCAGGCCAGGTGCGG - Intronic
938690720 2:133786710-133786732 TTGATGATTTAGGCCAGGCGCGG + Intergenic
939283062 2:140090145-140090167 TTGTTTATTTTGGCCAGGCGCGG + Intergenic
939595238 2:144114936-144114958 CTGAAAATTCAGGCCAGGCATGG + Intronic
940262644 2:151798402-151798424 CTTTTTATTTAGGCCAGGCGCGG + Intronic
940882606 2:158961632-158961654 AAGGTTATTTAGGCCAGGCGTGG + Intergenic
941446226 2:165603183-165603205 CAGGAGATTCAGGCCGGGCGCGG - Intronic
943315215 2:186378659-186378681 ATATTTACTCAGGCCAGGCGCGG - Intergenic
947215648 2:227747623-227747645 CCAGGTATTCTGGCCAGGCGTGG + Intergenic
947500921 2:230670285-230670307 CTGGGTTCTCAGGCCGGGCGTGG + Intergenic
1168748493 20:265312-265334 AAAGTTATTGAGGCCAGGCGCGG - Intergenic
1169159363 20:3363306-3363328 GTCTTTATTCTGGCCAGGCGTGG + Intronic
1170931192 20:20770640-20770662 CAGGTGGTTCAGGCCAGGCATGG - Intergenic
1172556156 20:35843227-35843249 GTGATCATTCTGGCCAGGCGTGG + Intronic
1172686146 20:36756268-36756290 CTTCTTGTTAAGGCCAGGCGCGG - Intronic
1172836890 20:37878887-37878909 CTGGTTCTTCAGACCAGGAATGG + Intergenic
1173178970 20:40787403-40787425 CTGGTTAGGGAGGCCAGGCCAGG + Intergenic
1173510603 20:43625218-43625240 TAGGGTGTTCAGGCCAGGCGTGG + Intronic
1173521627 20:43704304-43704326 GTGGTTAGTTAGGCCAGGCGCGG - Intronic
1174486825 20:50866377-50866399 CAGGTCCTGCAGGCCAGGCGGGG + Intronic
1174816092 20:53688471-53688493 CTGTTTCTACAGGCCGGGCGCGG + Intergenic
1176915049 21:14615588-14615610 CAGGTTATTTAGGTCAGGCCTGG - Intronic
1177800413 21:25823493-25823515 GTGATAATTCTGGCCAGGCGTGG + Intergenic
1177932784 21:27305626-27305648 ATGCTTCTTCCGGCCAGGCGCGG + Intergenic
1179451512 21:41471563-41471585 GTGGTGATTCAAGCCAGGCATGG - Intronic
1179930236 21:44565919-44565941 ATGGTATTTCAGGCCAGGTGTGG + Intronic
1180908732 22:19433213-19433235 CTGCTTCTCCAGGCTAGGCGCGG - Intronic
1181016713 22:20074207-20074229 CTGGAAATTCTGGCCAGGTGTGG + Intergenic
1182215860 22:28717086-28717108 AATGTTACTCAGGCCAGGCGCGG + Intronic
1182658822 22:31910662-31910684 CAGATTATACAGGCCAGGTGCGG + Intergenic
1183377065 22:37471517-37471539 CTTGTGATTCTGGCCAGGGGTGG - Intronic
1184218046 22:43080343-43080365 ATGGTTAAAGAGGCCAGGCGCGG - Intronic
1184575733 22:45364137-45364159 ATAGTTATTTGGGCCAGGCGCGG - Intronic
1184703224 22:46191775-46191797 ATAGATATTGAGGCCAGGCGCGG + Intronic
1184714765 22:46274639-46274661 CTGGTAAGTCAGCCCAGGTGTGG + Intronic
949234259 3:1789732-1789754 TTGGGGTTTCAGGCCAGGCGCGG + Intergenic
949449882 3:4174064-4174086 ATGGTTACCCAGGCCAGGCACGG + Intronic
950798890 3:15533498-15533520 AAAGTAATTCAGGCCAGGCGCGG + Intergenic
952285279 3:31962245-31962267 TTGGTGATGCCGGCCAGGCGCGG - Intronic
952311651 3:32195939-32195961 CATATTATACAGGCCAGGCGAGG - Intergenic
953165657 3:40462664-40462686 CTGATTATTTAGGCCAGGCGCGG - Intergenic
953166941 3:40473546-40473568 ATGGTGGCTCAGGCCAGGCGCGG - Intergenic
953754498 3:45634945-45634967 TTGTTTTTTCAGGCCAGGCGCGG + Intronic
953997170 3:47528905-47528927 ATGCATGTTCAGGCCAGGCGAGG + Intergenic
954178037 3:48859751-48859773 CTAATAATTCAGGCCAAGCGCGG - Intronic
954905993 3:54063383-54063405 CTGGTTGACTAGGCCAGGCGTGG + Intergenic
955265914 3:57444479-57444501 CAGGTTAAACAGGCCAGGCACGG - Intronic
955390031 3:58515309-58515331 ATGTTTGTTCAGGCCAGGCGCGG - Intronic
956116424 3:65923513-65923535 ATGTTTATTGAGGCCAGGCGTGG - Intronic
957658593 3:83117023-83117045 AAGGTTAGTAAGGCCAGGCGTGG + Intergenic
959059261 3:101601284-101601306 CTGCTTTTGCAGGCCGGGCGCGG + Intergenic
959995978 3:112680502-112680524 GAAGATATTCAGGCCAGGCGCGG - Intergenic
960497417 3:118391789-118391811 ATGTTCCTTCAGGCCAGGCGCGG - Intergenic
966179540 3:177175766-177175788 TAAGTTATTCAGGCCAGGCGCGG + Intronic
966202151 3:177368515-177368537 GTGGAAATACAGGCCAGGCGCGG - Intergenic
966420982 3:179733752-179733774 CTAGTTATTAAGACCATGCGTGG - Intronic
966673935 3:182564506-182564528 GTGTTTATCCAGGCCAGGTGGGG - Intergenic
966891254 3:184409200-184409222 ATGATAATGCAGGCCAGGCGCGG - Intronic
969558285 4:7928674-7928696 CTGGTAAAGTAGGCCAGGCGTGG - Intronic
970871750 4:20824389-20824411 GTGATTCTTTAGGCCAGGCGTGG + Intronic
972355879 4:38279270-38279292 CTGGTTCTGCAGGCCCGGGGTGG - Intergenic
972743382 4:41909888-41909910 CTGGAAATGCAGGCCAGGTGTGG + Intergenic
973134165 4:46685662-46685684 CTGCTTATTTGGGCCAGGCACGG + Intergenic
974928018 4:68325671-68325693 CTGAGCATTCAGGCCAGGTGTGG - Intronic
974941868 4:68478743-68478765 ATGGTGATACAGGCCAGGCACGG - Intronic
975554954 4:75653077-75653099 TTGGGTATTCAGGCAATGCGTGG - Intronic
975566465 4:75760854-75760876 AAGGTTTTTCTGGCCAGGCGTGG + Intronic
977063194 4:92281329-92281351 TAGAGTATTCAGGCCAGGCGCGG + Intergenic
977091004 4:92675842-92675864 ATGGTAGCTCAGGCCAGGCGTGG - Intronic
978745029 4:112183420-112183442 TTAGTAAATCAGGCCAGGCGAGG - Intronic
979295113 4:119023064-119023086 ATAATTATTCAGGCCAGGCGTGG - Intronic
979359625 4:119746450-119746472 CTGTATATTTAGGCCAGGCACGG + Intergenic
979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG + Intronic
980225598 4:129980081-129980103 CTCGTGATTCCGGCCAGGCACGG + Intergenic
980243115 4:130202355-130202377 CAGGATCTTCAGGCCAGGCACGG + Intergenic
981563628 4:146074505-146074527 AAGTGTATTCAGGCCAGGCGAGG - Intergenic
982336094 4:154239797-154239819 TTAGTTTTTCTGGCCAGGCGTGG - Intronic
984938815 4:184913461-184913483 CTGCTAATTCTGGCCAGGCATGG - Intergenic
986071695 5:4291220-4291242 ATGTATATCCAGGCCAGGCGCGG - Intergenic
988829546 5:34974033-34974055 CTGTTTTTTATGGCCAGGCGCGG - Intergenic
988962754 5:36386074-36386096 CTGTTTCTTCAGGCCAGAGGAGG + Intergenic
989962462 5:50432786-50432808 CTAGTTATCAGGGCCAGGCGCGG + Intronic
990219847 5:53575830-53575852 CTGATCATTTAGGCCAGGTGTGG - Intronic
990864445 5:60365751-60365773 CTGGCCATTTCGGCCAGGCGTGG + Intronic
990911489 5:60857069-60857091 AAAGTTATTCAGGCCGGGCGTGG - Intergenic
991061763 5:62383531-62383553 CTGGCTGTGCAGGCCGGGCGTGG - Intronic
992026845 5:72678648-72678670 CTGGTTGTTCTGGCTAGGAGTGG + Intergenic
992067709 5:73122687-73122709 GTGGTTCTTGAGGCCAGGCGTGG - Intronic
992975918 5:82119749-82119771 GTGGTAATTCAGGCCAGGCACGG - Intronic
993714034 5:91256657-91256679 ATAGATGTTCAGGCCAGGCGTGG + Intergenic
995708223 5:115007566-115007588 GTGGTTTTGCAGGCCAGGCCTGG + Intergenic
996154069 5:120076700-120076722 GTTCATATTCAGGCCAGGCGGGG - Intergenic
996536954 5:124587345-124587367 CTGTTGATGGAGGCCAGGCGCGG - Intergenic
997137184 5:131338955-131338977 ATGCTTGTTCAGGCCGGGCGTGG + Intronic
997294316 5:132760327-132760349 ATGGTCTTTCAGGCCAGGGGCGG - Intronic
998058432 5:139099105-139099127 ATGTCTATTCAGGCCAGGTGTGG - Intronic
998534357 5:142915648-142915670 GAGGAGATTCAGGCCAGGCGTGG - Intronic
999163825 5:149530675-149530697 CCAGCTACTCAGGCCAGGCGCGG + Intronic
999393494 5:151211812-151211834 ATGGAGATTCCGGCCAGGCGTGG - Intronic
999420118 5:151433579-151433601 TATGTTATTCAGGCCGGGCGTGG - Intergenic
999644756 5:153706802-153706824 GTGGAATTTCAGGCCAGGCGTGG + Intronic
1005077289 6:21920800-21920822 ATGATTATTCAGGCCAGGCACGG + Intergenic
1006518324 6:34556745-34556767 CTGGCTACTCAGGCCAGGGATGG + Intergenic
1008072668 6:47113446-47113468 CTGATTATCTAGGCCAGGCGCGG + Intergenic
1008100204 6:47381841-47381863 TTACTTATTGAGGCCAGGCGTGG - Intergenic
1008951117 6:57160623-57160645 AAGGATATTGAGGCCAGGCGTGG - Intronic
1010771538 6:79837288-79837310 CTGGTGCTTCAGACCAGGCCTGG + Intergenic
1011206306 6:84903057-84903079 CTCATTATTAAGCCCAGGCGTGG + Intergenic
1011665286 6:89627312-89627334 ATGAATATACAGGCCAGGCGTGG - Intronic
1013108751 6:107048418-107048440 CTAGAAATACAGGCCAGGCGTGG - Intronic
1013586251 6:111581685-111581707 TTGATTCTTAAGGCCAGGCGTGG + Intronic
1014795405 6:125718804-125718826 CTCATTATTAGGGCCAGGCGCGG - Intergenic
1017132335 6:151118341-151118363 CTGTTAAATCAGGCCAGGAGCGG - Intergenic
1017243128 6:152193719-152193741 TAGTTTATACAGGCCAGGCGCGG + Intronic
1018069682 6:160153004-160153026 AAGGTTTTTTAGGCCAGGCGCGG - Intronic
1018156051 6:160986245-160986267 ATAGACATTCAGGCCAGGCGTGG - Intergenic
1018569814 6:165196992-165197014 CTAGTGTTTCAGGCCGGGCGCGG + Intergenic
1019161249 6:170068222-170068244 CTGGACATTCAGGTCAGACGAGG + Intergenic
1019712482 7:2523993-2524015 CTGGTTAACCGGGCCAGGCTGGG - Intronic
1019879028 7:3842145-3842167 CTGGTGATTCAGGCCAGCCCTGG - Intronic
1022510939 7:30934429-30934451 CTGGGCATTCTGGCCAGGCCAGG + Intergenic
1022615978 7:31930548-31930570 AAGCTTATCCAGGCCAGGCGTGG + Intronic
1022707710 7:32820161-32820183 CTGTTAATCCAGGCCAGGTGCGG - Intergenic
1022914825 7:34937641-34937663 AAGTTTTTTCAGGCCAGGCGTGG + Intronic
1023450705 7:40282084-40282106 CTGGATATTCAGGCTGGGTGCGG - Intronic
1023810613 7:43908366-43908388 ATGCTTATTTAGGCCAGGCATGG - Intronic
1023821380 7:43982543-43982565 ATGGTGGTTAAGGCCAGGCGTGG - Intergenic
1023952644 7:44859111-44859133 ATGTATATTCTGGCCAGGCGTGG - Intergenic
1024293570 7:47825237-47825259 CTGGTCCTTTAGGCCAGGTGTGG + Intronic
1024503902 7:50144969-50144991 CTGCTTTTTCAGGCCTGGCACGG + Intronic
1025000159 7:55309219-55309241 CTGGTTATTGAGGCCTAGTGTGG - Intergenic
1025077070 7:55952440-55952462 ATGGTGATTCAAGCCGGGCGCGG + Intronic
1026008354 7:66617233-66617255 TCAGTTATTCAGGCCAGGCACGG - Intergenic
1026477837 7:70752013-70752035 CAGTGTATGCAGGCCAGGCGTGG - Intronic
1027435811 7:78163427-78163449 CTAATTATTTAGGCCAGGCACGG - Intronic
1029320442 7:99754338-99754360 ATGTCTATTCAGGCCGGGCGCGG + Intergenic
1029728044 7:102421177-102421199 CTGCTTCTTCAGGTCACGCGTGG - Intronic
1029749642 7:102535965-102535987 ATGGTGGTTAAGGCCAGGCGTGG - Intergenic
1029767592 7:102635069-102635091 ATGGTGGTTAAGGCCAGGCGTGG - Intronic
1029845683 7:103409995-103410017 CTGCTAATTAAGGCCGGGCGTGG - Intronic
1029990731 7:104960443-104960465 ATGCTTCTTCCGGCCAGGCGCGG + Intergenic
1030299063 7:107957097-107957119 CTGGATATTCCGGCCAGGTGCGG + Intronic
1031107726 7:117566141-117566163 CAGGTATTTGAGGCCAGGCGTGG + Intronic
1031132431 7:117848105-117848127 ATGGTTAGGCAGGCCAGGCGTGG - Intronic
1032142025 7:129340275-129340297 ATAGTTTTTCAGGCCGGGCGCGG + Intronic
1032614204 7:133448812-133448834 ATGGAAATTTAGGCCAGGCGTGG + Intronic
1033104996 7:138512700-138512722 ATGGTTTTACAGGCCAGGCCAGG - Intronic
1033659285 7:143392651-143392673 TTGGTTCTCCAGGCCAGGCGAGG + Intronic
1034506158 7:151493129-151493151 CTGGGAATTTAGGGCAGGCGCGG - Intronic
1035049910 7:155992700-155992722 CTGGGTGTTGAGGCGAGGCGGGG + Intergenic
1036577976 8:10046391-10046413 TTGGTGATTCACGCCAGGCACGG + Intergenic
1036759893 8:11500916-11500938 CTTTTTATTTTGGCCAGGCGTGG + Intronic
1038179757 8:25215141-25215163 ATGGTTCTTCAGGCCAGGGAAGG + Intronic
1038549472 8:28453871-28453893 ATATTTATTCAGGCCAGGCGTGG + Intronic
1038669499 8:29571041-29571063 ATAGATAGTCAGGCCAGGCGTGG - Intergenic
1041354703 8:56988016-56988038 ATAGTTATTGAGGCCTGGCGTGG - Intronic
1041734106 8:61091902-61091924 CTGGTTATTCAGGACAAGTTTGG + Intronic
1042590635 8:70394443-70394465 CATGTTATTTTGGCCAGGCGCGG - Intronic
1042894620 8:73652415-73652437 CTGTTATTTCTGGCCAGGCGCGG + Intronic
1044724538 8:95182279-95182301 GTAGTCATTCAGGCCAGGCGAGG - Intergenic
1046321930 8:112590297-112590319 CTGGCTATTCAGGACAGGTCAGG - Intronic
1047587220 8:126285503-126285525 ATAGTTTTTCAGGCCAGGCATGG - Intergenic
1048349319 8:133603379-133603401 CTTGTTACTCAGGCCAGGTGTGG - Intergenic
1050379168 9:5008017-5008039 CTCATTATTAGGGCCAGGCGCGG - Intronic
1050661776 9:7890939-7890961 ATGGTAATACAGGCCAGGTGTGG + Intergenic
1050856246 9:10360810-10360832 TTTGTCATTAAGGCCAGGCGCGG + Intronic
1051933158 9:22411178-22411200 TTGGCTATTCCGGCCAGGCGCGG - Intergenic
1052753835 9:32520853-32520875 CTGGTGACTCAGGCCGGGTGTGG + Intronic
1053094932 9:35317825-35317847 ATGCTTGTTTAGGCCAGGCGTGG - Intronic
1053795691 9:41725078-41725100 CAGAATATACAGGCCAGGCGTGG - Intergenic
1054184101 9:61937133-61937155 CAGAATATACAGGCCAGGCGTGG - Intergenic
1054654404 9:67651346-67651368 CAGAATATACAGGCCAGGCGTGG + Intergenic
1055250808 9:74302975-74302997 TTTTTGATTCAGGCCAGGCGTGG + Intergenic
1056646830 9:88420083-88420105 AGTTTTATTCAGGCCAGGCGCGG + Intronic
1059737147 9:117113363-117113385 CAGCATATTTAGGCCAGGCGTGG + Intronic
1060228456 9:121810195-121810217 ATGAAAATTCAGGCCAGGCGCGG + Intergenic
1060366551 9:123021609-123021631 CTGTTTTTCCAGGCCAGGTGAGG - Intronic
1061152075 9:128834531-128834553 CAGGTTCCTCAGGCCAGGCACGG + Intronic
1061607808 9:131724609-131724631 CTGGTGTTTCAGGACAGGAGTGG - Intronic
1061655055 9:132083121-132083143 ATGGCCATCCAGGCCAGGCGTGG + Intergenic
1062543906 9:137053431-137053453 CTGGGTATTCAGCCCAGATGGGG - Intronic
1185649029 X:1635272-1635294 GAGTTAATTCAGGCCAGGCGCGG - Intronic
1186867877 X:13739453-13739475 ATGTTTATACAGGCCGGGCGTGG + Intronic
1187435214 X:19261532-19261554 ATGGTAAATCAGGCCAGGGGCGG - Intergenic
1187627302 X:21130407-21130429 GTAGTTAATCAAGCCAGGCGCGG + Intergenic
1187736111 X:22305247-22305269 CAGGTGATTCAGGGCAGGCCAGG - Intergenic
1189337829 X:40181356-40181378 CTGGTTAGTCAGGACAGGGCTGG + Intergenic
1189763453 X:44345254-44345276 TCTGTTATTGAGGCCAGGCGCGG + Intergenic
1190152258 X:47958149-47958171 CTTGTGATTTAGGCCAGGTGGGG + Intronic
1190160404 X:48027979-48028001 CTTGTGATTTAGGCCAGGTGGGG - Intronic
1192214954 X:69151575-69151597 GCAGGTATTCAGGCCAGGCGTGG + Intergenic
1194677955 X:96815959-96815981 GTTGTTGTTCAGGCCAGGCGCGG - Intronic
1195310986 X:103631522-103631544 ATGCTTAGTAAGGCCAGGCGCGG + Intergenic
1196673604 X:118395730-118395752 CTTGATATTGAGGCCAGGTGTGG + Intronic
1196730216 X:118934142-118934164 CTGGTCTTTCAGGCCAGGCATGG + Intergenic
1197582915 X:128307738-128307760 ATGTATATTCAGGCCAGGTGCGG - Intergenic
1198372406 X:136003277-136003299 ATGGTTATCTAGGCCGGGCGTGG - Intronic
1199017657 X:142837469-142837491 ATGAAGATTCAGGCCAGGCGCGG - Intergenic