ID: 926028921

View in Genome Browser
Species Human (GRCh38)
Location 2:9568713-9568735
Sequence AATACTAACCTGCCTCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926028921_926028924 10 Left 926028921 2:9568713-9568735 CCTGTCAGAGGCAGGTTAGTATT No data
Right 926028924 2:9568746-9568768 TTCTTTTTTTGGTAGAGACAGGG 0: 13
1: 686
2: 8973
3: 99182
4: 236143
926028921_926028923 9 Left 926028921 2:9568713-9568735 CCTGTCAGAGGCAGGTTAGTATT No data
Right 926028923 2:9568745-9568767 CTTCTTTTTTTGGTAGAGACAGG No data
926028921_926028922 -1 Left 926028921 2:9568713-9568735 CCTGTCAGAGGCAGGTTAGTATT No data
Right 926028922 2:9568735-9568757 TTTTATTTTACTTCTTTTTTTGG No data
926028921_926028925 29 Left 926028921 2:9568713-9568735 CCTGTCAGAGGCAGGTTAGTATT No data
Right 926028925 2:9568765-9568787 AGGGTCTTGCCATGTTGACCAGG 0: 12
1: 903
2: 11459
3: 47654
4: 130300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926028921 Original CRISPR AATACTAACCTGCCTCTGAC AGG (reversed) Intergenic
No off target data available for this crispr