ID: 926035049

View in Genome Browser
Species Human (GRCh38)
Location 2:9630158-9630180
Sequence ATCCATCTGCACCACGGTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926035049 Original CRISPR ATCCATCTGCACCACGGTGC TGG (reversed) Exonic
903667506 1:25017013-25017035 AACCATCTGCCCCCCAGTGCTGG - Intergenic
904298969 1:29541935-29541957 ATCCTTCTGGAGCACGGAGCAGG + Intergenic
906668003 1:47635247-47635269 ACCCATCTGCACCACAGGCCTGG - Intergenic
919388181 1:196948083-196948105 ATCCATATACACGATGGTGCAGG - Intronic
920966782 1:210707624-210707646 AAACATCTTCACCACGTTGCTGG + Intronic
922604158 1:226878822-226878844 TTCCATCTGCAGCAGTGTGCTGG - Intronic
923812179 1:237330895-237330917 CTCCATCTGCACCTTTGTGCTGG + Exonic
1067689737 10:48494060-48494082 TTCCATCTTCACCACAGTCCTGG - Intronic
1068863243 10:61868055-61868077 CTCCACCTGCAGCCCGGTGCAGG + Intergenic
1075082155 10:119391377-119391399 ACCCATCTGAAGCACCGTGCAGG + Intronic
1075133371 10:119759962-119759984 AACCATCTGCACCAAGGAGACGG - Intronic
1075414307 10:122250778-122250800 ATCCATCTGCCCAACGATACAGG - Intronic
1075651099 10:124128737-124128759 GTCCACCTCCACCGCGGTGCTGG - Intergenic
1076326754 10:129629752-129629774 ATCCATCAAAACCACAGTGCAGG + Intronic
1079639845 11:22791343-22791365 ATCCATCTACACCATGGACCTGG - Intronic
1080086347 11:28287611-28287633 ATCCATGTGCACCATTGTGGTGG + Intronic
1081104158 11:39044003-39044025 TTCCATCTGCTCCACGTGGCAGG + Intergenic
1088606549 11:111539090-111539112 ATCCATCTGAACCAAGGTCCAGG + Intergenic
1088895359 11:114074344-114074366 ATCCATCGGGCCCACAGTGCTGG + Intronic
1090007726 11:123017631-123017653 CTCCTTCTCCACCATGGTGCCGG - Intergenic
1090133488 11:124170670-124170692 CTCCACCTGCAGCCCGGTGCGGG - Intergenic
1094217558 12:27960474-27960496 ATCCACCTGCCCCAAAGTGCTGG - Intronic
1097137637 12:56871959-56871981 ATCCATCTGTACCACAGTCCTGG + Intergenic
1112427947 13:99321550-99321572 ATCCATCTGCCTCAAAGTGCTGG + Intronic
1116274068 14:42807778-42807800 ATCCATCTGCACCAGGGTCTTGG - Intergenic
1116653836 14:47626917-47626939 CTCCACCTGCACCCCGGTGCGGG + Intronic
1117644374 14:57835979-57836001 AACCATCTGCATCAAGATGCAGG + Intronic
1121525934 14:94619330-94619352 CTTCAGCTCCACCACGGTGCAGG - Exonic
1121526062 14:94620376-94620398 CTTCAGCTCCACCACGGTGCAGG + Intronic
1124110545 15:26781617-26781639 CTCCACCTGCACCCCCGTGCGGG - Intronic
1124689470 15:31810078-31810100 CACCATCTGCACCACCTTGCAGG - Intronic
1127828362 15:62726632-62726654 ATCCAGCTGCACCACCTTCCTGG - Intronic
1129678301 15:77644011-77644033 ATCCATCAGAGCCACGGGGCAGG + Intronic
1131598130 15:93820056-93820078 TTCCATATGCACCAAGGTGATGG + Intergenic
1133062342 16:3183110-3183132 ACCCATCTGCACCACGCCGCCGG - Intergenic
1133444106 16:5845536-5845558 ATCAACCTGGACCAAGGTGCAGG - Intergenic
1148699120 17:49577375-49577397 ATCCAGATGCCCCCCGGTGCTGG + Intronic
1149474814 17:56951658-56951680 ATTCATGTGCACCACTGTGGTGG - Intronic
1151280627 17:73071556-73071578 AACCATCGGGACCACTGTGCTGG - Intronic
1151331438 17:73411544-73411566 TTCCGTCTGCCCCACGTTGCTGG + Intronic
1203159780 17_GL000205v2_random:38720-38742 ATCCATCTGCTCACCGCTGCCGG + Intergenic
1153637656 18:7127144-7127166 CTCCAACTCCACCATGGTGCAGG + Intergenic
1153907873 18:9679072-9679094 GTCAATCTGCAGCACGATGCAGG + Intergenic
1156551569 18:38024526-38024548 ATCCAACTGCACCACATTGCTGG + Intergenic
1160548693 18:79679615-79679637 ATGCCGCTGCTCCACGGTGCCGG + Intergenic
1161488874 19:4550821-4550843 GTCCATCTGGACGCCGGTGCCGG - Exonic
1165319270 19:35075689-35075711 CTCCATCTGCACCACTAAGCTGG - Intergenic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1167748086 19:51364530-51364552 ATCCGTCTCCCCCATGGTGCAGG - Intronic
926035049 2:9630158-9630180 ATCCATCTGCACCACGGTGCTGG - Exonic
926157568 2:10465597-10465619 ATCTATGTGCACAAGGGTGCTGG + Intergenic
926764409 2:16311675-16311697 ATCCCACTGCACCACGGTGAGGG + Intergenic
930686931 2:54319518-54319540 GTCCATCAGCTCCAAGGTGCAGG + Intergenic
933645695 2:84811057-84811079 AACCATCTGCAGCAGAGTGCAGG - Intronic
944843073 2:203642814-203642836 CTCCATCTGCGCCCTGGTGCGGG - Intergenic
945147656 2:206755312-206755334 CTCCATCTGCACGAAGGTGGAGG - Exonic
945375297 2:209072734-209072756 ATCAAGCTGTACCAGGGTGCAGG - Intergenic
946092644 2:217243870-217243892 ACCTATATGCACCACAGTGCTGG - Intergenic
946934804 2:224708949-224708971 ATTTATCTGCACAACTGTGCAGG - Intergenic
947708128 2:232292885-232292907 TTCCAACTGCACAACGGTCCTGG - Intronic
947874874 2:233461363-233461385 ATCCATCTGCACGCCAGGGCTGG - Intronic
948484725 2:238273103-238273125 CTCCATCTCCTCCACGGTGTAGG + Exonic
1175156025 20:56972276-56972298 ATCCATCTGCTCCACTGTCCTGG + Intergenic
1176361398 21:5999741-5999763 ATCCATCTGCACCATGCCCCAGG - Intergenic
1177780840 21:25621136-25621158 ATCAATCTGCACCAGGTAGCTGG + Intergenic
1178491936 21:33057972-33057994 ACCCATCTGCAGTACAGTGCTGG + Intergenic
1179762120 21:43538809-43538831 ATCCATCTGCACCATGCCCCAGG + Intronic
1184242878 22:43220683-43220705 TTCCGTCTGCACCACGGACCAGG - Intronic
950068888 3:10136384-10136406 CTCCACCTGCGCCCCGGTGCAGG - Intergenic
950450286 3:13061477-13061499 ATCCAGCTGCACCACTGGGCTGG - Intronic
953206863 3:40838627-40838649 TTCCATCTCCACCAGGGTGCAGG - Intergenic
958464888 3:94444983-94445005 GTACATGTGCACAACGGTGCAGG - Intergenic
960227462 3:115184836-115184858 CTCCACCTGCAGCCCGGTGCGGG - Intergenic
961066446 3:123881051-123881073 ATCCATCTGCAGAATGGTGCAGG + Intronic
961357467 3:126348102-126348124 CTCCCTCTGCACCCCGGTGTTGG - Intronic
966301757 3:178486837-178486859 ACCCATCAGCACCAGGGAGCTGG - Intronic
966850751 3:184163748-184163770 ATCCACCTGCATCCCTGTGCTGG + Intronic
967148654 3:186627999-186628021 TCCCACCTGCACCACTGTGCAGG + Intergenic
974083254 4:57234094-57234116 CTCCATCTGCAGCATGGGGCGGG - Intergenic
975754924 4:77562354-77562376 CTCCACCTGCACCGGGGTGCAGG + Intronic
977696485 4:99971748-99971770 ATCCCTCTGCATCACTTTGCTGG + Intergenic
977885697 4:102250244-102250266 CTCCACCTGCGCCCCGGTGCAGG - Intergenic
978373030 4:108048297-108048319 ATCCATCAGCACCCCAGTGGAGG - Exonic
982921343 4:161277640-161277662 CTCCACCTGCAGCCCGGTGCGGG + Intergenic
983124421 4:163932789-163932811 ATCGATCGGCACCATGGTCCTGG + Intronic
985724073 5:1506500-1506522 ACCCATCTGCACCAGGGCGTGGG - Intronic
986152076 5:5138198-5138220 CTCCACCTGCGCCCCGGTGCGGG + Intergenic
986993344 5:13578883-13578905 CTCCACCTGCAGCCCGGTGCCGG + Intergenic
987352228 5:17032422-17032444 CTCCACCTGCGCCCCGGTGCAGG - Intergenic
997742635 5:136270571-136270593 ATCTATATGCAACACGATGCTGG + Intronic
1004285571 6:14317802-14317824 ATGCATCAGGACCACGGTGTTGG + Intergenic
1013315977 6:108943575-108943597 ATCCATCTGCCGCAAAGTGCTGG - Intronic
1019441667 7:1050568-1050590 GTCCGCCTGCACCAGGGTGCAGG - Intronic
1028303229 7:89228715-89228737 CTCCACCTGCACCCCGGTGTGGG - Intronic
1047433579 8:124815432-124815454 ATCCAGCAGCACCATGGTCCTGG + Intergenic
1058997766 9:110316436-110316458 AGCCATCTGCATCACGTTGCAGG + Intronic
1059934219 9:119291691-119291713 ATCCATCTGCAACTGGATGCTGG - Intronic
1060791480 9:126488538-126488560 ATCCCTCTGCACCACGTGGGAGG + Intronic
1062331717 9:136047839-136047861 ATGCATCTGCCCCTGGGTGCTGG - Intronic
1062357313 9:136170948-136170970 ATCCATCTTCCCCACGGGCCTGG + Intergenic
1191821355 X:65312439-65312461 ATGAATCTGCACCTCTGTGCTGG + Intergenic
1193658345 X:84225269-84225291 CTCTCTCTGCACCACGGAGCTGG + Intergenic
1197887881 X:131237015-131237037 ATCCATCTGCAACAGGGTTCAGG + Intergenic
1200085891 X:153604885-153604907 GTCGATCTGCAGAACGGTGCGGG + Intergenic