ID: 926035276

View in Genome Browser
Species Human (GRCh38)
Location 2:9631063-9631085
Sequence CGGGACTCTCGGGAGAAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926035276_926035296 30 Left 926035276 2:9631063-9631085 CCGAGCTTCTCCCGAGAGTCCCG No data
Right 926035296 2:9631116-9631138 GAGCGCGCGGAAGGGGGCGAGGG No data
926035276_926035293 24 Left 926035276 2:9631063-9631085 CCGAGCTTCTCCCGAGAGTCCCG No data
Right 926035293 2:9631110-9631132 AGGACCGAGCGCGCGGAAGGGGG No data
926035276_926035295 29 Left 926035276 2:9631063-9631085 CCGAGCTTCTCCCGAGAGTCCCG No data
Right 926035295 2:9631115-9631137 CGAGCGCGCGGAAGGGGGCGAGG No data
926035276_926035292 23 Left 926035276 2:9631063-9631085 CCGAGCTTCTCCCGAGAGTCCCG No data
Right 926035292 2:9631109-9631131 GAGGACCGAGCGCGCGGAAGGGG No data
926035276_926035286 4 Left 926035276 2:9631063-9631085 CCGAGCTTCTCCCGAGAGTCCCG No data
Right 926035286 2:9631090-9631112 CAGCGCGCCGCTGGCCAATGAGG No data
926035276_926035279 -5 Left 926035276 2:9631063-9631085 CCGAGCTTCTCCCGAGAGTCCCG No data
Right 926035279 2:9631081-9631103 TCCCGCCCCCAGCGCGCCGCTGG No data
926035276_926035291 22 Left 926035276 2:9631063-9631085 CCGAGCTTCTCCCGAGAGTCCCG No data
Right 926035291 2:9631108-9631130 TGAGGACCGAGCGCGCGGAAGGG No data
926035276_926035288 17 Left 926035276 2:9631063-9631085 CCGAGCTTCTCCCGAGAGTCCCG No data
Right 926035288 2:9631103-9631125 GCCAATGAGGACCGAGCGCGCGG No data
926035276_926035290 21 Left 926035276 2:9631063-9631085 CCGAGCTTCTCCCGAGAGTCCCG No data
Right 926035290 2:9631107-9631129 ATGAGGACCGAGCGCGCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926035276 Original CRISPR CGGGACTCTCGGGAGAAGCT CGG (reversed) Intergenic