ID: 926035276

View in Genome Browser
Species Human (GRCh38)
Location 2:9631063-9631085
Sequence CGGGACTCTCGGGAGAAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 67}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926035276_926035286 4 Left 926035276 2:9631063-9631085 CCGAGCTTCTCCCGAGAGTCCCG 0: 1
1: 0
2: 1
3: 5
4: 67
Right 926035286 2:9631090-9631112 CAGCGCGCCGCTGGCCAATGAGG 0: 1
1: 0
2: 1
3: 5
4: 53
926035276_926035290 21 Left 926035276 2:9631063-9631085 CCGAGCTTCTCCCGAGAGTCCCG 0: 1
1: 0
2: 1
3: 5
4: 67
Right 926035290 2:9631107-9631129 ATGAGGACCGAGCGCGCGGAAGG 0: 1
1: 0
2: 0
3: 1
4: 39
926035276_926035293 24 Left 926035276 2:9631063-9631085 CCGAGCTTCTCCCGAGAGTCCCG 0: 1
1: 0
2: 1
3: 5
4: 67
Right 926035293 2:9631110-9631132 AGGACCGAGCGCGCGGAAGGGGG 0: 1
1: 0
2: 0
3: 2
4: 58
926035276_926035279 -5 Left 926035276 2:9631063-9631085 CCGAGCTTCTCCCGAGAGTCCCG 0: 1
1: 0
2: 1
3: 5
4: 67
Right 926035279 2:9631081-9631103 TCCCGCCCCCAGCGCGCCGCTGG 0: 1
1: 0
2: 2
3: 51
4: 246
926035276_926035295 29 Left 926035276 2:9631063-9631085 CCGAGCTTCTCCCGAGAGTCCCG 0: 1
1: 0
2: 1
3: 5
4: 67
Right 926035295 2:9631115-9631137 CGAGCGCGCGGAAGGGGGCGAGG 0: 1
1: 0
2: 6
3: 33
4: 262
926035276_926035291 22 Left 926035276 2:9631063-9631085 CCGAGCTTCTCCCGAGAGTCCCG 0: 1
1: 0
2: 1
3: 5
4: 67
Right 926035291 2:9631108-9631130 TGAGGACCGAGCGCGCGGAAGGG 0: 1
1: 0
2: 0
3: 0
4: 34
926035276_926035296 30 Left 926035276 2:9631063-9631085 CCGAGCTTCTCCCGAGAGTCCCG 0: 1
1: 0
2: 1
3: 5
4: 67
Right 926035296 2:9631116-9631138 GAGCGCGCGGAAGGGGGCGAGGG 0: 1
1: 0
2: 1
3: 9
4: 217
926035276_926035288 17 Left 926035276 2:9631063-9631085 CCGAGCTTCTCCCGAGAGTCCCG 0: 1
1: 0
2: 1
3: 5
4: 67
Right 926035288 2:9631103-9631125 GCCAATGAGGACCGAGCGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 53
926035276_926035292 23 Left 926035276 2:9631063-9631085 CCGAGCTTCTCCCGAGAGTCCCG 0: 1
1: 0
2: 1
3: 5
4: 67
Right 926035292 2:9631109-9631131 GAGGACCGAGCGCGCGGAAGGGG 0: 1
1: 0
2: 0
3: 3
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926035276 Original CRISPR CGGGACTCTCGGGAGAAGCT CGG (reversed) Intergenic
900526266 1:3130275-3130297 TGGGGTTCTGGGGAGAAGCTGGG + Intronic
900711601 1:4118206-4118228 ATGGACTCTCAGGAAAAGCTCGG + Intergenic
901472486 1:9467353-9467375 CGGGTCTCTTTGGAGAGGCTTGG - Intergenic
902615608 1:17621964-17621986 AGGGTCTCTGGGGAGAAGCAGGG + Intronic
902983993 1:20144282-20144304 CGGGGCTCTGGGGGAAAGCTGGG + Intronic
903115743 1:21176985-21177007 CGGGATTCTTCGGAGACGCTCGG + Intergenic
904869763 1:33609152-33609174 AGGGAGCCTCAGGAGAAGCTGGG - Intronic
914691101 1:150028317-150028339 CGGGATTCTCAAGAGAACCTGGG + Intergenic
1062860495 10:806005-806027 CTGGACTCTCGGAAGGATCTGGG + Intergenic
1062971369 10:1651738-1651760 CGTGACTCTCGGGGGGAGCGGGG + Intronic
1066784426 10:38987446-38987468 CGGGACTCAGGGGAAAGGCTGGG - Intergenic
1076488725 10:130841399-130841421 CGGGACTCACGGGAAAGGGTGGG + Intergenic
1076675727 10:132146607-132146629 CGGCCCTCTGGGGAGAAGCTAGG + Intronic
1077303017 11:1855798-1855820 GGGGACTCTCTGGTGACGCTGGG + Intronic
1078090986 11:8264531-8264553 CAGGATTCTGGGGAGAAGCAGGG - Intronic
1083714332 11:64567170-64567192 AGGGCCTCTCGGGAGACCCTGGG - Intronic
1084212072 11:67628974-67628996 CGGGAAACCCGGGAGGAGCTGGG - Exonic
1089301670 11:117502632-117502654 GGGAACTCTGGGGAGAGGCTGGG + Intronic
1097419267 12:59353810-59353832 GGGGAGTTTGGGGAGAAGCTGGG + Intergenic
1103995522 12:124827550-124827572 GGGGAGGCTGGGGAGAAGCTGGG + Intronic
1105502961 13:20988626-20988648 CGGGACTCCCTGCAGAAGCCGGG - Exonic
1106203265 13:27562582-27562604 CGGGACTCTGGTGAACAGCTTGG - Exonic
1106227674 13:27797162-27797184 GCGGACTCTGGGGAGAAGCTGGG - Intergenic
1106597980 13:31162453-31162475 TGGGACTCGCGAGAGAGGCTGGG + Intergenic
1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG + Intronic
1119291722 14:73500631-73500653 CAGGAAGCTTGGGAGAAGCTTGG + Exonic
1122817525 14:104320930-104320952 CGGGACTCTCGGCAGAGGCTGGG + Intergenic
1123092536 14:105748140-105748162 CCGTACTCACGGGAGAAGGTGGG + Intergenic
1123098096 14:105775841-105775863 CCGTACTCACGGGAGAAGGTGGG + Intergenic
1127814204 15:62592211-62592233 CAGGACTCTCAGAAGCAGCTAGG - Intronic
1132856567 16:2047718-2047740 CGGGCCTCTCCGGAGAAGAGAGG - Exonic
1134755762 16:16665936-16665958 GGGGCCTCTCGGGAGTAGATTGG - Intergenic
1134858926 16:17543585-17543607 GGGGACTCAAGAGAGAAGCTTGG - Intergenic
1134990304 16:18693229-18693251 GGGGCCTCTCGGGAGTAGATTGG + Intergenic
1148553483 17:48564365-48564387 CGGGACGCTCGGGGGTTGCTGGG - Intronic
1152290545 17:79437528-79437550 CGGGACACCCGGTAGGAGCTGGG + Intronic
1166038893 19:40190894-40190916 CGGGACTCTGCGGGGAAGATGGG - Intergenic
1168636852 19:58003106-58003128 CGGGTTTCCCGGGAGGAGCTCGG + Exonic
926035276 2:9631063-9631085 CGGGACTCTCGGGAGAAGCTCGG - Intergenic
933723602 2:85413630-85413652 TAGGACTCTCGGGAGCGGCTAGG + Intronic
938583644 2:132669619-132669641 CTGCACCGTCGGGAGAAGCTGGG - Intronic
940672269 2:156685435-156685457 CAGGTCTCTCAGGAGAAGATAGG - Intergenic
940954431 2:159712428-159712450 CGCCACTCTCGCGAGAAGCCAGG + Intergenic
946399496 2:219461035-219461057 GGGGACCCTGGGGAGAACCTAGG + Intronic
948617815 2:239212726-239212748 CTGGACTCCAGGGAGGAGCTGGG + Intronic
1174848349 20:53966466-53966488 GGGGACTCAGGGGAGAAGGTTGG + Intronic
1181511943 22:23393186-23393208 CAGGACCTTCGGGAGCAGCTGGG + Intergenic
1183258149 22:36776322-36776344 CGGGACTCTCAGGCGCAGCGGGG - Intergenic
950247258 3:11432485-11432507 TGGGACTTGAGGGAGAAGCTTGG + Intronic
950986717 3:17378919-17378941 CAGAACTCTGGGGAGAAGATGGG - Intronic
952955734 3:38556175-38556197 TGAGACTCCTGGGAGAAGCTGGG - Intronic
956122979 3:65984649-65984671 CCTTACTCTCGGGAGTAGCTGGG + Intronic
960700708 3:120436721-120436743 TGGGACTCTAGGGAGAAGCCAGG + Intronic
966990945 3:185229466-185229488 AGTGAGTCTGGGGAGAAGCTGGG + Exonic
975097543 4:70474783-70474805 CAGGATTCTCAGGAGAAGATAGG + Intronic
981401003 4:144313748-144313770 CGGGACTATTGGGAGAGGCATGG - Intergenic
985430186 4:189871719-189871741 TGGGAGTCTGGGGAGAATCTTGG - Intergenic
986768224 5:10947661-10947683 CAGGAGTCTCTGGAGAGGCTGGG - Intergenic
986972657 5:13355133-13355155 TGGGACCCCCAGGAGAAGCTGGG + Intergenic
989956700 5:50368540-50368562 CGGATCTCTCGGCAGAAACTAGG + Intergenic
1001308701 5:170595113-170595135 CAGGACTCTCTGGGGAAGCTAGG - Intronic
1002512601 5:179732809-179732831 CGGGCCTCTCGGAAGAAGGCGGG - Intergenic
1003171089 6:3722785-3722807 CGGGAATCACGAGGGAAGCTGGG - Exonic
1015380020 6:132556433-132556455 GGGGACTCAGGGGAGAAGGTTGG - Intergenic
1018456987 6:163961805-163961827 CGGCACTCTGGGGTGAGGCTGGG + Intergenic
1028086568 7:86644368-86644390 TGGGACTCTTGGCAGAAGCACGG - Exonic
1033544238 7:142385666-142385688 AGGGACTCTGGGGAGAGCCTGGG + Intergenic
1034272211 7:149808843-149808865 CTGGTCTCTAGGGAGAAGCTGGG - Intergenic
1037770298 8:21795026-21795048 CGAGGCCCTGGGGAGAAGCTGGG - Intronic
1053145291 9:35707669-35707691 GGGGACTCGGGGGAGAAGATAGG + Intronic
1061164865 9:128916437-128916459 CGGGAGTTCTGGGAGAAGCTAGG - Exonic
1187341555 X:18425759-18425781 CTCCACTCTCAGGAGAAGCTGGG - Intronic
1192735908 X:73849788-73849810 AGTGACTTTCGAGAGAAGCTGGG + Intergenic
1196145502 X:112312448-112312470 CAGGACTCCTGGGAGAACCTTGG + Intergenic