ID: 926037656

View in Genome Browser
Species Human (GRCh38)
Location 2:9647770-9647792
Sequence CTGCTTTACCACATAGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926037656_926037661 24 Left 926037656 2:9647770-9647792 CCTTGCACTATGTGGTAAAGCAG No data
Right 926037661 2:9647817-9647839 TTATTTATTGAGACCTGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926037656 Original CRISPR CTGCTTTACCACATAGTGCA AGG (reversed) Intergenic
No off target data available for this crispr