ID: 926041965

View in Genome Browser
Species Human (GRCh38)
Location 2:9680658-9680680
Sequence CCTGATTAACACTTATTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926041960_926041965 2 Left 926041960 2:9680633-9680655 CCATAGCATCTTCCCCTACATTT No data
Right 926041965 2:9680658-9680680 CCTGATTAACACTTATTCTTAGG No data
926041961_926041965 -10 Left 926041961 2:9680645-9680667 CCCCTACATTTTGCCTGATTAAC No data
Right 926041965 2:9680658-9680680 CCTGATTAACACTTATTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926041965 Original CRISPR CCTGATTAACACTTATTCTT AGG Intergenic
No off target data available for this crispr