ID: 926043984

View in Genome Browser
Species Human (GRCh38)
Location 2:9696145-9696167
Sequence CTTTGAACACAGGTTGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926043984_926043990 -9 Left 926043984 2:9696145-9696167 CCTTGTACAACCTGTGTTCAAAG No data
Right 926043990 2:9696159-9696181 TGTTCAAAGGAACGGACCAGGGG No data
926043984_926043989 -10 Left 926043984 2:9696145-9696167 CCTTGTACAACCTGTGTTCAAAG No data
Right 926043989 2:9696158-9696180 GTGTTCAAAGGAACGGACCAGGG No data
926043984_926043996 29 Left 926043984 2:9696145-9696167 CCTTGTACAACCTGTGTTCAAAG No data
Right 926043996 2:9696197-9696219 TAGATAAGGAGGGAATTTTCAGG No data
926043984_926043993 18 Left 926043984 2:9696145-9696167 CCTTGTACAACCTGTGTTCAAAG No data
Right 926043993 2:9696186-9696208 GATGCCATTTATAGATAAGGAGG No data
926043984_926043992 15 Left 926043984 2:9696145-9696167 CCTTGTACAACCTGTGTTCAAAG No data
Right 926043992 2:9696183-9696205 TCAGATGCCATTTATAGATAAGG No data
926043984_926043994 19 Left 926043984 2:9696145-9696167 CCTTGTACAACCTGTGTTCAAAG No data
Right 926043994 2:9696187-9696209 ATGCCATTTATAGATAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926043984 Original CRISPR CTTTGAACACAGGTTGTACA AGG (reversed) Intergenic
No off target data available for this crispr