ID: 926046811

View in Genome Browser
Species Human (GRCh38)
Location 2:9716064-9716086
Sequence GGAAAGCAATTGAGTCTCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926046811_926046818 23 Left 926046811 2:9716064-9716086 CCTCGGAGACTCAATTGCTTTCC No data
Right 926046818 2:9716110-9716132 CATGCTCTGCCCATCCCAGCAGG No data
926046811_926046820 27 Left 926046811 2:9716064-9716086 CCTCGGAGACTCAATTGCTTTCC No data
Right 926046820 2:9716114-9716136 CTCTGCCCATCCCAGCAGGTGGG No data
926046811_926046819 26 Left 926046811 2:9716064-9716086 CCTCGGAGACTCAATTGCTTTCC No data
Right 926046819 2:9716113-9716135 GCTCTGCCCATCCCAGCAGGTGG No data
926046811_926046812 -9 Left 926046811 2:9716064-9716086 CCTCGGAGACTCAATTGCTTTCC No data
Right 926046812 2:9716078-9716100 TTGCTTTCCCTGCATCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926046811 Original CRISPR GGAAAGCAATTGAGTCTCCG AGG (reversed) Intergenic
No off target data available for this crispr