ID: 926046812

View in Genome Browser
Species Human (GRCh38)
Location 2:9716078-9716100
Sequence TTGCTTTCCCTGCATCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926046811_926046812 -9 Left 926046811 2:9716064-9716086 CCTCGGAGACTCAATTGCTTTCC No data
Right 926046812 2:9716078-9716100 TTGCTTTCCCTGCATCCCAGTGG No data
926046807_926046812 26 Left 926046807 2:9716029-9716051 CCCTTACCAGGAGCAGGGCTTTG No data
Right 926046812 2:9716078-9716100 TTGCTTTCCCTGCATCCCAGTGG No data
926046808_926046812 25 Left 926046808 2:9716030-9716052 CCTTACCAGGAGCAGGGCTTTGA No data
Right 926046812 2:9716078-9716100 TTGCTTTCCCTGCATCCCAGTGG No data
926046809_926046812 20 Left 926046809 2:9716035-9716057 CCAGGAGCAGGGCTTTGAGTTAT No data
Right 926046812 2:9716078-9716100 TTGCTTTCCCTGCATCCCAGTGG No data
926046806_926046812 27 Left 926046806 2:9716028-9716050 CCCCTTACCAGGAGCAGGGCTTT No data
Right 926046812 2:9716078-9716100 TTGCTTTCCCTGCATCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926046812 Original CRISPR TTGCTTTCCCTGCATCCCAG TGG Intergenic
No off target data available for this crispr