ID: 926046816

View in Genome Browser
Species Human (GRCh38)
Location 2:9716094-9716116
Sequence GAGCATGGACTTGCTTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926046816_926046820 -3 Left 926046816 2:9716094-9716116 CCAGTGGAAGCAAGTCCATGCTC No data
Right 926046820 2:9716114-9716136 CTCTGCCCATCCCAGCAGGTGGG No data
926046816_926046818 -7 Left 926046816 2:9716094-9716116 CCAGTGGAAGCAAGTCCATGCTC No data
Right 926046818 2:9716110-9716132 CATGCTCTGCCCATCCCAGCAGG No data
926046816_926046819 -4 Left 926046816 2:9716094-9716116 CCAGTGGAAGCAAGTCCATGCTC No data
Right 926046819 2:9716113-9716135 GCTCTGCCCATCCCAGCAGGTGG No data
926046816_926046826 25 Left 926046816 2:9716094-9716116 CCAGTGGAAGCAAGTCCATGCTC No data
Right 926046826 2:9716142-9716164 CCGTTGTTAGCAGCAGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926046816 Original CRISPR GAGCATGGACTTGCTTCCAC TGG (reversed) Intergenic
No off target data available for this crispr