ID: 926046820

View in Genome Browser
Species Human (GRCh38)
Location 2:9716114-9716136
Sequence CTCTGCCCATCCCAGCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926046813_926046820 6 Left 926046813 2:9716085-9716107 CCCTGCATCCCAGTGGAAGCAAG No data
Right 926046820 2:9716114-9716136 CTCTGCCCATCCCAGCAGGTGGG No data
926046815_926046820 -2 Left 926046815 2:9716093-9716115 CCCAGTGGAAGCAAGTCCATGCT No data
Right 926046820 2:9716114-9716136 CTCTGCCCATCCCAGCAGGTGGG No data
926046811_926046820 27 Left 926046811 2:9716064-9716086 CCTCGGAGACTCAATTGCTTTCC No data
Right 926046820 2:9716114-9716136 CTCTGCCCATCCCAGCAGGTGGG No data
926046814_926046820 5 Left 926046814 2:9716086-9716108 CCTGCATCCCAGTGGAAGCAAGT No data
Right 926046820 2:9716114-9716136 CTCTGCCCATCCCAGCAGGTGGG No data
926046816_926046820 -3 Left 926046816 2:9716094-9716116 CCAGTGGAAGCAAGTCCATGCTC No data
Right 926046820 2:9716114-9716136 CTCTGCCCATCCCAGCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926046820 Original CRISPR CTCTGCCCATCCCAGCAGGT GGG Intergenic
No off target data available for this crispr