ID: 926046826

View in Genome Browser
Species Human (GRCh38)
Location 2:9716142-9716164
Sequence CCGTTGTTAGCAGCAGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926046822_926046826 -1 Left 926046822 2:9716120-9716142 CCATCCCAGCAGGTGGGTGAGAC No data
Right 926046826 2:9716142-9716164 CCGTTGTTAGCAGCAGCACCTGG No data
926046816_926046826 25 Left 926046816 2:9716094-9716116 CCAGTGGAAGCAAGTCCATGCTC No data
Right 926046826 2:9716142-9716164 CCGTTGTTAGCAGCAGCACCTGG No data
926046823_926046826 -5 Left 926046823 2:9716124-9716146 CCCAGCAGGTGGGTGAGACCGTT No data
Right 926046826 2:9716142-9716164 CCGTTGTTAGCAGCAGCACCTGG No data
926046824_926046826 -6 Left 926046824 2:9716125-9716147 CCAGCAGGTGGGTGAGACCGTTG No data
Right 926046826 2:9716142-9716164 CCGTTGTTAGCAGCAGCACCTGG No data
926046817_926046826 10 Left 926046817 2:9716109-9716131 CCATGCTCTGCCCATCCCAGCAG No data
Right 926046826 2:9716142-9716164 CCGTTGTTAGCAGCAGCACCTGG No data
926046821_926046826 0 Left 926046821 2:9716119-9716141 CCCATCCCAGCAGGTGGGTGAGA No data
Right 926046826 2:9716142-9716164 CCGTTGTTAGCAGCAGCACCTGG No data
926046815_926046826 26 Left 926046815 2:9716093-9716115 CCCAGTGGAAGCAAGTCCATGCT No data
Right 926046826 2:9716142-9716164 CCGTTGTTAGCAGCAGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926046826 Original CRISPR CCGTTGTTAGCAGCAGCACC TGG Intergenic
No off target data available for this crispr