ID: 926049858

View in Genome Browser
Species Human (GRCh38)
Location 2:9737720-9737742
Sequence CAGGGGTACTAGAGGGAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926049858_926049877 26 Left 926049858 2:9737720-9737742 CCCCATTCCCTCTAGTACCCCTG No data
Right 926049877 2:9737769-9737791 CTAGTGCCCCCCACTTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926049858 Original CRISPR CAGGGGTACTAGAGGGAATG GGG (reversed) Intergenic
No off target data available for this crispr