ID: 926050112

View in Genome Browser
Species Human (GRCh38)
Location 2:9739394-9739416
Sequence GGTCTGCAGAAGCGGCGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926050112_926050115 -4 Left 926050112 2:9739394-9739416 CCCACACGCCGCTTCTGCAGACC No data
Right 926050115 2:9739413-9739435 GACCCAGCTCATCCTGTTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926050112 Original CRISPR GGTCTGCAGAAGCGGCGTGT GGG (reversed) Intergenic
No off target data available for this crispr