ID: 926050727

View in Genome Browser
Species Human (GRCh38)
Location 2:9742916-9742938
Sequence CCTCTTGGAAGCCATCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926050727_926050732 -1 Left 926050727 2:9742916-9742938 CCTCCATGATGGCTTCCAAGAGG No data
Right 926050732 2:9742938-9742960 GCTGAGTGAGCATGCGCTTAGGG No data
926050727_926050731 -2 Left 926050727 2:9742916-9742938 CCTCCATGATGGCTTCCAAGAGG No data
Right 926050731 2:9742937-9742959 GGCTGAGTGAGCATGCGCTTAGG No data
926050727_926050733 10 Left 926050727 2:9742916-9742938 CCTCCATGATGGCTTCCAAGAGG No data
Right 926050733 2:9742949-9742971 ATGCGCTTAGGGCACCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926050727 Original CRISPR CCTCTTGGAAGCCATCATGG AGG (reversed) Intergenic
No off target data available for this crispr